EMAIL THIS PAGE TO A FRIEND

TLE4

transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)

Synonyms: BCE-1 BCE1 E(spI) ESG ESG4 GRG4
Gene ID:
Mouse(21888) transducin-like enhancer of split 4, homolog of Drosophila E(spl)
Rat(25565) transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
chicken(374080) transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
dog(476317) transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
domestic cat(101098173) transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
domestic guinea pig(100716273) transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
cow(508893) transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
sheep(101111783) transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
182 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007005 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150551 MISSION® esiRNA esiRNA human TLE4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007005 Rosetta Predictions human pricing
NM_019141 Rosetta Predictions rat pricing
NM_011600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342759 predicted 1074
2 SASI_Hs01_00186657 predicted 3046
3 SASI_Hs01_00186658 predicted 888
4 SASI_Hs01_00186659 predicted 1101
5 SASI_Hs01_00186660 predicted 1489
6 SASI_Hs01_00186661 predicted 1046
7 SASI_Hs01_00186662 predicted 1206
8 SASI_Hs01_00186665 predicted 1747
9 SASI_Hs01_00186666 predicted 1689
10 SASI_Hs02_00342760 predicted 1581
11 SASI_Hs01_00186663 predicted 2904
12 SASI_Hs01_00186664 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261903 predicted 2306
2 SASI_Rn01_00113169 predicted 359
3 SASI_Rn01_00113170 predicted 1547
4 SASI_Rn02_00261904 predicted 1359
5 SASI_Rn01_00113172 predicted 758
6 SASI_Rn01_00113173 predicted 1387
7 SASI_Rn01_00113174 predicted 1947
8 SASI_Rn01_00113176 predicted 1097
9 SASI_Rn01_00113177 predicted 444
10 SASI_Rn02_00261905 predicted 300
11 SASI_Rn01_00113168 predicted 268
12 SASI_Rn01_00113171 predicted 1441
13 SASI_Rn01_00113175 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195239 predicted 2788
2 SASI_Mm02_00321016 predicted 1234
3 SASI_Mm01_00195240 predicted 757
4 SASI_Mm01_00195242 predicted 787
5 SASI_Mm01_00195243 predicted 944
6 SASI_Mm01_00195244 predicted 2925
7 SASI_Mm01_00195245 predicted 839
8 SASI_Mm01_00195246 predicted 696
9 SASI_Mm01_00195247 predicted 2721
10 SASI_Mm02_00321017 predicted 1388
11 SASI_Mm01_00195241 predicted 2985
12 SASI_Mm01_00195248 predicted 1459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007005
VALIDATED
TLE4 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007005.3-3356s21c1
Sequence:CCGGGCTGTCTACTTGGAAGAACATCTCGAGATGTTCTTCCAAGTAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-3074s21c1
Sequence:CCGGACATCTCCGTGGACGACAAATCTCGAGATTTGTCGTCCACGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-2455s21c1
Sequence:CCGGCCTGATGGTCGCACCCTAATTCTCGAGAATTAGGGTGCGACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-1413s21c1
Sequence:CCGGCCAAAGAGACAGAGACTCCATCTCGAGATGGAGTCTCTGTCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-1195s21c1
Sequence:CCGGGCAGAACTGAACGCCATCATTCTCGAGAATGATGGCGTTCAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-1413s1c1
Sequence:CCGGCCAAAGAGACAGAGACTCCATCTCGAGATGGAGTCTCTGTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160491    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007005.3-4272s1c1
Sequence:CCGGCCAGAAACATTGTGTTATCTTCTCGAGAAGATAACACAATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-3356s1c1
Sequence:CCGGGCTGTCTACTTGGAAGAACATCTCGAGATGTTCTTCCAAGTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-1195s1c1
Sequence:CCGGGCAGAACTGAACGCCATCATTCTCGAGAATGATGGCGTTCAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007005.3-1363s1c1
Sequence:CCGGCAGTCCCATCTTCCAATTAAACTCGAGTTTAATTGGAAGATGGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-3855s1c1
Sequence:CCGGCGTTGACAAGTGTCTTTGTAACTCGAGTTACAAAGACACTTGTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007005.3-2901s1c1
Sequence:CCGGGCCAGACAAATACCAACTACACTCGAGTGTAGTTGGTATTTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007005
VALIDATED
TLE4 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007005.3-3356s21c1
Sequence:CCGGGCTGTCTACTTGGAAGAACATCTCGAGATGTTCTTCCAAGTAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-3074s21c1
Sequence:CCGGACATCTCCGTGGACGACAAATCTCGAGATTTGTCGTCCACGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-2455s21c1
Sequence:CCGGCCTGATGGTCGCACCCTAATTCTCGAGAATTAGGGTGCGACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-1413s21c1
Sequence:CCGGCCAAAGAGACAGAGACTCCATCTCGAGATGGAGTCTCTGTCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-1195s21c1
Sequence:CCGGGCAGAACTGAACGCCATCATTCTCGAGAATGATGGCGTTCAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-1413s1c1
Sequence:CCGGCCAAAGAGACAGAGACTCCATCTCGAGATGGAGTCTCTGTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160491    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007005.3-4272s1c1
Sequence:CCGGCCAGAAACATTGTGTTATCTTCTCGAGAAGATAACACAATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-3356s1c1
Sequence:CCGGGCTGTCTACTTGGAAGAACATCTCGAGATGTTCTTCCAAGTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-1195s1c1
Sequence:CCGGGCAGAACTGAACGCCATCATTCTCGAGAATGATGGCGTTCAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007005.3-1363s1c1
Sequence:CCGGCAGTCCCATCTTCCAATTAAACTCGAGTTTAATTGGAAGATGGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-3855s1c1
Sequence:CCGGCGTTGACAAGTGTCTTTGTAACTCGAGTTACAAAGACACTTGTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007005.3-2901s1c1
Sequence:CCGGGCCAGACAAATACCAACTACACTCGAGTGTAGTTGGTATTTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007005
VALIDATED
TLE4 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007005.3-3356s21c1
Sequence:CCGGGCTGTCTACTTGGAAGAACATCTCGAGATGTTCTTCCAAGTAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-3074s21c1
Sequence:CCGGACATCTCCGTGGACGACAAATCTCGAGATTTGTCGTCCACGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-2455s21c1
Sequence:CCGGCCTGATGGTCGCACCCTAATTCTCGAGAATTAGGGTGCGACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-1413s21c1
Sequence:CCGGCCAAAGAGACAGAGACTCCATCTCGAGATGGAGTCTCTGTCTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007005.3-1195s21c1
Sequence:CCGGGCAGAACTGAACGCCATCATTCTCGAGAATGATGGCGTTCAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-1413s1c1
Sequence:CCGGCCAAAGAGACAGAGACTCCATCTCGAGATGGAGTCTCTGTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160491    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007005.3-4272s1c1
Sequence:CCGGCCAGAAACATTGTGTTATCTTCTCGAGAAGATAACACAATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-3356s1c1
Sequence:CCGGGCTGTCTACTTGGAAGAACATCTCGAGATGTTCTTCCAAGTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-1195s1c1
Sequence:CCGGGCAGAACTGAACGCCATCATTCTCGAGAATGATGGCGTTCAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158445    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007005.3-1363s1c1
Sequence:CCGGCAGTCCCATCTTCCAATTAAACTCGAGTTTAATTGGAAGATGGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_007005.3-3855s1c1
Sequence:CCGGCGTTGACAAGTGTCTTTGTAACTCGAGTTACAAAGACACTTGTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007005.3-2901s1c1
Sequence:CCGGGCCAGACAAATACCAACTACACTCGAGTGTAGTTGGTATTTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011600
VALIDATED
TLE4 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011600.2-3825s1c1
Sequence:CCGGCGCTGTGCAAAGCAAGTCTTTCTCGAGAAAGACTTGCTTTGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011600.2-1114s1c1
Sequence:CCGGCCTCCCAATTAAGGATGAGAACTCGAGTTCTCATCCTTAATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011600.2-2645s1c1
Sequence:CCGGCCAGACAAATACCAGTTGCATCTCGAGATGCAACTGGTATTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011600.2-764s1c1
Sequence:CCGGCGGCATTATGTCATGTATTATCTCGAGATAATACATGACATAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011600.2-1877s1c1
Sequence:CCGGCCTCCAAATCTAACAGGCATTCTCGAGAATGCCTGTTAGATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011600
VALIDATED
TLE4 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011600.2-3825s1c1
Sequence:CCGGCGCTGTGCAAAGCAAGTCTTTCTCGAGAAAGACTTGCTTTGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011600.2-1114s1c1
Sequence:CCGGCCTCCCAATTAAGGATGAGAACTCGAGTTCTCATCCTTAATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011600.2-2645s1c1
Sequence:CCGGCCAGACAAATACCAGTTGCATCTCGAGATGCAACTGGTATTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011600.2-764s1c1
Sequence:CCGGCGGCATTATGTCATGTATTATCTCGAGATAATACATGACATAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011600.2-1877s1c1
Sequence:CCGGCCTCCAAATCTAACAGGCATTCTCGAGAATGCCTGTTAGATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011600
VALIDATED
TLE4 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011600.2-3825s1c1
Sequence:CCGGCGCTGTGCAAAGCAAGTCTTTCTCGAGAAAGACTTGCTTTGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011600.2-1114s1c1
Sequence:CCGGCCTCCCAATTAAGGATGAGAACTCGAGTTCTCATCCTTAATTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011600.2-2645s1c1
Sequence:CCGGCCAGACAAATACCAGTTGCATCTCGAGATGCAACTGGTATTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011600.2-764s1c1
Sequence:CCGGCGGCATTATGTCATGTATTATCTCGAGATAATACATGACATAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011600.2-1877s1c1
Sequence:CCGGCCTCCAAATCTAACAGGCATTCTCGAGAATGCCTGTTAGATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks