EMAIL THIS PAGE TO A FRIEND

TLE6

transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)

Synonyms: GRG6
UniProtKB ID: Q9H808, J3KMZ1
Gene ID:
Mouse(114606) transducin-like enhancer of split 6, homolog of Drosophila E(spl)
sheep(101119725) transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
domestic guinea pig(100715921) transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
naked mole-rat(101717744) transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
dog(485066) transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
domestic cat(101086290) transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024760 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024760 Rosetta Predictions human pricing
NM_053254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121627 predicted 805
2 SASI_Hs01_00121628 predicted 1032
3 SASI_Hs01_00121629 predicted 1099
4 SASI_Hs01_00121630 predicted 1341
5 SASI_Hs01_00121631 predicted 979
6 SASI_Hs01_00121632 predicted 974
7 SASI_Hs01_00121633 predicted 787
8 SASI_Hs01_00121634 predicted 1586
9 SASI_Hs01_00121635 predicted 798
10 SASI_Hs01_00121636 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039696 predicted 201
2 SASI_Mm02_00337871 predicted 539
3 SASI_Mm01_00039697 predicted 916
4 SASI_Mm02_00337872 predicted 1781
5 SASI_Mm01_00039698 predicted 1391
6 SASI_Mm01_00039701 predicted 392
7 SASI_Mm02_00337873 predicted 1508
8 SASI_Mm02_00337874 predicted 1207
9 SASI_Mm02_00337875 predicted 1792
10 SASI_Mm02_00337876 predicted 1263
11 SASI_Mm01_00039695 predicted 1673
12 SASI_Mm01_00039699 predicted 709
13 SASI_Mm01_00039700 predicted 694
14 SASI_Mm01_00039702 predicted 1732
15 SASI_Mm01_00039703 predicted 1425
16 SASI_Mm01_00039704 predicted 462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024760
TLE6 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-804s1c1
Sequence:CCGGCTCTCGGTTTCTACAGTCCATCTCGAGATGGACTGTAGAAACCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1639s1c1
Sequence:CCGGGTTGGAATGGACGACTTCCTTCTCGAGAAGGAAGTCGTCCATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1340s1c1
Sequence:CCGGGTTATCCTGATGGAGTCAAGACTCGAGTCTTGACTCCATCAGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1447s1c1
Sequence:CCGGCTGGAGTACCAATTCAAGTCTCTCGAGAGACTTGAATTGGTACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1434s1c1
Sequence:CCGGCATCATGAAACCTCTGGAGTACTCGAGTACTCCAGAGGTTTCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024760.2-1539s21c1
Sequence:CCGGTCATCCTGAGCGTCAAGTTCTCTCGAGAGAACTTGACGCTCAGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024760.2-1887s21c1
Sequence:CCGGTGGTCGCCATCACGTGTAATACTCGAGTATTACACGTGATGGCGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024760.2-1853s21c1
Sequence:CCGGTGTGGCATCGCACGATCTAGTCTCGAGACTAGATCGTGCGATGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024760
TLE6 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-804s1c1
Sequence:CCGGCTCTCGGTTTCTACAGTCCATCTCGAGATGGACTGTAGAAACCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1639s1c1
Sequence:CCGGGTTGGAATGGACGACTTCCTTCTCGAGAAGGAAGTCGTCCATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1340s1c1
Sequence:CCGGGTTATCCTGATGGAGTCAAGACTCGAGTCTTGACTCCATCAGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1447s1c1
Sequence:CCGGCTGGAGTACCAATTCAAGTCTCTCGAGAGACTTGAATTGGTACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1434s1c1
Sequence:CCGGCATCATGAAACCTCTGGAGTACTCGAGTACTCCAGAGGTTTCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024760.2-1539s21c1
Sequence:CCGGTCATCCTGAGCGTCAAGTTCTCTCGAGAGAACTTGACGCTCAGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024760.2-1887s21c1
Sequence:CCGGTGGTCGCCATCACGTGTAATACTCGAGTATTACACGTGATGGCGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024760.2-1853s21c1
Sequence:CCGGTGTGGCATCGCACGATCTAGTCTCGAGACTAGATCGTGCGATGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024760
TLE6 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-804s1c1
Sequence:CCGGCTCTCGGTTTCTACAGTCCATCTCGAGATGGACTGTAGAAACCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1639s1c1
Sequence:CCGGGTTGGAATGGACGACTTCCTTCTCGAGAAGGAAGTCGTCCATTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1340s1c1
Sequence:CCGGGTTATCCTGATGGAGTCAAGACTCGAGTCTTGACTCCATCAGGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1447s1c1
Sequence:CCGGCTGGAGTACCAATTCAAGTCTCTCGAGAGACTTGAATTGGTACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024760.1-1434s1c1
Sequence:CCGGCATCATGAAACCTCTGGAGTACTCGAGTACTCCAGAGGTTTCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024760.2-1539s21c1
Sequence:CCGGTCATCCTGAGCGTCAAGTTCTCTCGAGAGAACTTGACGCTCAGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024760.2-1887s21c1
Sequence:CCGGTGGTCGCCATCACGTGTAATACTCGAGTATTACACGTGATGGCGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024760.2-1853s21c1
Sequence:CCGGTGTGGCATCGCACGATCTAGTCTCGAGACTAGATCGTGCGATGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053254
VALIDATED
TLE6 MISSION shRNA Bacterial Glycerol Stock
transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053254.1-189s1c1
Sequence:CCGGCCACCTTATCCAGTCGGTATTCTCGAGAATACCGACTGGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053254.1-188s1c1
Sequence:CCGGTCCACCTTATCCAGTCGGTATCTCGAGATACCGACTGGATAAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053254.1-1436s1c1
Sequence:CCGGAGGAACCTTGTGGTCAAAGATCTCGAGATCTTTGACCACAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053254.1-1433s1c1
Sequence:CCGGGCCAGGAACCTTGTGGTCAAACTCGAGTTTGACCACAAGGTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053254.1-803s1c1
Sequence:CCGGCCCTCAGCTCTTCTAGATTATCTCGAGATAATCTAGAAGAGCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053254
VALIDATED
TLE6 MISSION shRNA shRNA Plasmid DNA
transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053254.1-189s1c1
Sequence:CCGGCCACCTTATCCAGTCGGTATTCTCGAGAATACCGACTGGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053254.1-188s1c1
Sequence:CCGGTCCACCTTATCCAGTCGGTATCTCGAGATACCGACTGGATAAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053254.1-1436s1c1
Sequence:CCGGAGGAACCTTGTGGTCAAAGATCTCGAGATCTTTGACCACAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053254.1-1433s1c1
Sequence:CCGGGCCAGGAACCTTGTGGTCAAACTCGAGTTTGACCACAAGGTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053254.1-803s1c1
Sequence:CCGGCCCTCAGCTCTTCTAGATTATCTCGAGATAATCTAGAAGAGCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053254
VALIDATED
TLE6 MISSION shRNA Lentiviral Transduction Particles
transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053254.1-189s1c1
Sequence:CCGGCCACCTTATCCAGTCGGTATTCTCGAGAATACCGACTGGATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053254.1-188s1c1
Sequence:CCGGTCCACCTTATCCAGTCGGTATCTCGAGATACCGACTGGATAAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053254.1-1436s1c1
Sequence:CCGGAGGAACCTTGTGGTCAAAGATCTCGAGATCTTTGACCACAAGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053254.1-1433s1c1
Sequence:CCGGGCCAGGAACCTTGTGGTCAAACTCGAGTTTGACCACAAGGTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053254.1-803s1c1
Sequence:CCGGCCCTCAGCTCTTCTAGATTATCTCGAGATAATCTAGAAGAGCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks