EMAIL THIS PAGE TO A FRIEND

TLK1

tousled-like kinase 1

Synonyms: PKU-beta
Gene ID:
Human(9874) Summary: The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(228012) tousled-like kinase 1
Rat(311118) tousled-like kinase 1
chicken(429024) tousled-like kinase 1
domestic cat(101088770) tousled-like kinase 1
Horse(100052963) tousled-like kinase 1
dog(478795) tousled-like kinase 1
cow(537517) tousled-like kinase 1
sheep(101116707) tousled-like kinase 1
naked mole-rat(101697542) tousled-like kinase 1
Domestic Rabbit(100345497) tousled-like kinase 1
domestic guinea pig(100734588) tousled-like kinase 1
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012290 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012290 Rosetta Predictions human pricing
NM_001107734 Rosetta Predictions rat pricing
NM_172664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062685 predicted 685
2 SASI_Hs01_00062687 predicted 1312
3 SASI_Hs01_00062688 predicted 1370
4 SASI_Hs01_00062689 predicted 421
5 SASI_Hs01_00062690 predicted 903
6 SASI_Hs02_00344036 predicted 1236
7 SASI_Hs01_00062691 predicted 258
8 SASI_Hs01_00062692 predicted 361
9 SASI_Hs01_00062693 predicted 742
10 SASI_Hs01_00062694 predicted 1078
11 SASI_Hs01_00062686 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231745 predicted 422
2 SASI_Rn02_00231746 predicted 1182
3 SASI_Rn02_00231747 predicted 1716
4 SASI_Rn02_00231748 predicted 1701
5 SASI_Rn02_00231749 predicted 464
6 SASI_Rn02_00231750 predicted 1765
7 SASI_Rn02_00231751 predicted 1013
8 SASI_Rn02_00231752 predicted 213
9 SASI_Rn02_00231753 predicted 699
10 SASI_Rn02_00231754 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157241 predicted 1566
2 SASI_Mm01_00157243 predicted 2340
3 SASI_Mm01_00157244 predicted 2042
4 SASI_Mm01_00157245 predicted 806
5 SASI_Mm01_00157246 predicted 798
6 SASI_Mm01_00157247 predicted 2440
7 SASI_Mm01_00157249 predicted 578
8 SASI_Mm02_00344373 predicted 878
9 SASI_Mm02_00344374 predicted 2285
10 SASI_Mm01_00157250 predicted 1887
11 SASI_Mm01_00157242 predicted 532
12 SASI_Mm01_00157248 predicted 2356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172664
VALIDATED
TLK1 MISSION shRNA Bacterial Glycerol Stock
tousled-like kinase 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172664.3-889s21c1
Sequence:CCGGGTGATCTCAGGCGGCAAATAGCTCGAGCTATTTGCCGCCTGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172664.3-577s21c1
Sequence:CCGGGCCATAAGATCAGCGACTATTCTCGAGAATAGTCGCTGATCTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172664.2-3393s1c1
Sequence:CCGGGCGCTTTAATTGCTGCTAAATCTCGAGATTTAGCAGCAATTAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1544s1c1
Sequence:CCGGCGGCTTTAGTGAGGTCTATAACTCGAGTTATAGACCTCACTAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1833s1c1
Sequence:CCGGCGGTCTATTGTGATGCAGATTCTCGAGAATCTGCATCACAATAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1543s1c1
Sequence:CCGGGCGGCTTTAGTGAGGTCTATACTCGAGTATAGACCTCACTAAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1701s1c1
Sequence:CCGGCCCAGAATAGTTAAACTCTATCTCGAGATAGAGTTTAACTATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172664
VALIDATED
TLK1 MISSION shRNA shRNA Plasmid DNA
tousled-like kinase 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172664.3-889s21c1
Sequence:CCGGGTGATCTCAGGCGGCAAATAGCTCGAGCTATTTGCCGCCTGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172664.3-577s21c1
Sequence:CCGGGCCATAAGATCAGCGACTATTCTCGAGAATAGTCGCTGATCTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172664.2-3393s1c1
Sequence:CCGGGCGCTTTAATTGCTGCTAAATCTCGAGATTTAGCAGCAATTAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1544s1c1
Sequence:CCGGCGGCTTTAGTGAGGTCTATAACTCGAGTTATAGACCTCACTAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1833s1c1
Sequence:CCGGCGGTCTATTGTGATGCAGATTCTCGAGAATCTGCATCACAATAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1543s1c1
Sequence:CCGGGCGGCTTTAGTGAGGTCTATACTCGAGTATAGACCTCACTAAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1701s1c1
Sequence:CCGGCCCAGAATAGTTAAACTCTATCTCGAGATAGAGTTTAACTATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172664
VALIDATED
TLK1 MISSION shRNA Lentiviral Transduction Particles
tousled-like kinase 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172664.3-889s21c1
Sequence:CCGGGTGATCTCAGGCGGCAAATAGCTCGAGCTATTTGCCGCCTGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172664.3-577s21c1
Sequence:CCGGGCCATAAGATCAGCGACTATTCTCGAGAATAGTCGCTGATCTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172664.2-3393s1c1
Sequence:CCGGGCGCTTTAATTGCTGCTAAATCTCGAGATTTAGCAGCAATTAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1544s1c1
Sequence:CCGGCGGCTTTAGTGAGGTCTATAACTCGAGTTATAGACCTCACTAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1833s1c1
Sequence:CCGGCGGTCTATTGTGATGCAGATTCTCGAGAATCTGCATCACAATAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1543s1c1
Sequence:CCGGGCGGCTTTAGTGAGGTCTATACTCGAGTATAGACCTCACTAAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172664.2-1701s1c1
Sequence:CCGGCCCAGAATAGTTAAACTCTATCTCGAGATAGAGTTTAACTATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012290
VALIDATED
TLK1 MISSION shRNA Bacterial Glycerol Stock
tousled-like kinase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012290.4-3638s21c1
Sequence:CCGGCCCTTCTAGCTCTATTGTAAACTCGAGTTTACAATAGAGCTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012290.4-3610s21c1
Sequence:CCGGCCAGTTCTATGCAGGATAATGCTCGAGCATTATCCTGCATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012290.4-2677s21c1
Sequence:CCGGCCCACACATGAGAAGATCAAACTCGAGTTTGATCTTCTCATGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-3890s1c1
Sequence:CCGGGCTGAAATTGTAGAGAGTATACTCGAGTATACTCTCTACAATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-1974s1c1
Sequence:CCGGGCCACCAAAGATTTCCAACAACTCGAGTTGTTGGAAATCTTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-1717s1c1
Sequence:CCGGCGGTCTATTGTAATGCAGATTCTCGAGAATCTGCATTACAATAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-2238s1c1
Sequence:CCGGCCCACACATGAGAAGATCAAACTCGAGTTTGATCTTCTCATGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-368s1c1
Sequence:CCGGCGGAGAAGAAACAATCGGAATCTCGAGATTCCGATTGTTTCTTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-2158s1c1
Sequence:CCGGGCATTTATAAGACGCTGTTTGCTCGAGCAAACAGCGTCTTATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-1553s1c1
Sequence:CCGGGAGAGTATAGAATACACAAAGCTCGAGCTTTGTGTATTCTATACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-627s1c1
Sequence:CCGGCCACCCTATTGTACAACCAAACTCGAGTTTGGTTGTACAATAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-3198s1c1
Sequence:CCGGCCCTTCTAGCTCTATTGTAAACTCGAGTTTACAATAGAGCTAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-3170s1c1
Sequence:CCGGCCAGTTCTATGCAGGATAATGCTCGAGCATTATCCTGCATAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012290
VALIDATED
TLK1 MISSION shRNA shRNA Plasmid DNA
tousled-like kinase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012290.4-3638s21c1
Sequence:CCGGCCCTTCTAGCTCTATTGTAAACTCGAGTTTACAATAGAGCTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012290.4-3610s21c1
Sequence:CCGGCCAGTTCTATGCAGGATAATGCTCGAGCATTATCCTGCATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012290.4-2677s21c1
Sequence:CCGGCCCACACATGAGAAGATCAAACTCGAGTTTGATCTTCTCATGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-3890s1c1
Sequence:CCGGGCTGAAATTGTAGAGAGTATACTCGAGTATACTCTCTACAATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-1974s1c1
Sequence:CCGGGCCACCAAAGATTTCCAACAACTCGAGTTGTTGGAAATCTTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-1717s1c1
Sequence:CCGGCGGTCTATTGTAATGCAGATTCTCGAGAATCTGCATTACAATAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-2238s1c1
Sequence:CCGGCCCACACATGAGAAGATCAAACTCGAGTTTGATCTTCTCATGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-368s1c1
Sequence:CCGGCGGAGAAGAAACAATCGGAATCTCGAGATTCCGATTGTTTCTTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-2158s1c1
Sequence:CCGGGCATTTATAAGACGCTGTTTGCTCGAGCAAACAGCGTCTTATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-1553s1c1
Sequence:CCGGGAGAGTATAGAATACACAAAGCTCGAGCTTTGTGTATTCTATACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-627s1c1
Sequence:CCGGCCACCCTATTGTACAACCAAACTCGAGTTTGGTTGTACAATAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-3198s1c1
Sequence:CCGGCCCTTCTAGCTCTATTGTAAACTCGAGTTTACAATAGAGCTAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-3170s1c1
Sequence:CCGGCCAGTTCTATGCAGGATAATGCTCGAGCATTATCCTGCATAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012290
VALIDATED
TLK1 MISSION shRNA Lentiviral Transduction Particles
tousled-like kinase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012290.4-3638s21c1
Sequence:CCGGCCCTTCTAGCTCTATTGTAAACTCGAGTTTACAATAGAGCTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012290.4-3610s21c1
Sequence:CCGGCCAGTTCTATGCAGGATAATGCTCGAGCATTATCCTGCATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012290.4-2677s21c1
Sequence:CCGGCCCACACATGAGAAGATCAAACTCGAGTTTGATCTTCTCATGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-3890s1c1
Sequence:CCGGGCTGAAATTGTAGAGAGTATACTCGAGTATACTCTCTACAATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-1974s1c1
Sequence:CCGGGCCACCAAAGATTTCCAACAACTCGAGTTGTTGGAAATCTTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-1717s1c1
Sequence:CCGGCGGTCTATTGTAATGCAGATTCTCGAGAATCTGCATTACAATAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-2238s1c1
Sequence:CCGGCCCACACATGAGAAGATCAAACTCGAGTTTGATCTTCTCATGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-368s1c1
Sequence:CCGGCGGAGAAGAAACAATCGGAATCTCGAGATTCCGATTGTTTCTTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-2158s1c1
Sequence:CCGGGCATTTATAAGACGCTGTTTGCTCGAGCAAACAGCGTCTTATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-1553s1c1
Sequence:CCGGGAGAGTATAGAATACACAAAGCTCGAGCTTTGTGTATTCTATACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-627s1c1
Sequence:CCGGCCACCCTATTGTACAACCAAACTCGAGTTTGGTTGTACAATAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012290.3-3198s1c1
Sequence:CCGGCCCTTCTAGCTCTATTGTAAACTCGAGTTTACAATAGAGCTAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012290.3-3170s1c1
Sequence:CCGGCCAGTTCTATGCAGGATAATGCTCGAGCATTATCCTGCATAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks