EMAIL THIS PAGE TO A FRIEND

TLK2

tousled-like kinase 2

Synonyms: HsHPK PKU-ALPHA
UniProtKB ID: Q86UE8, D3DU07, Q9UKI7, Q9Y4F7
Gene ID:
Human(11011) Summary: The Tousled-like kinases, first described in Arabidopsis, are nuclear serine/threonine kinases that are potentially involved in the regulation of chromatin assembly.[supplied by OMIM, Apr 2004]
Mouse(24086) tousled-like kinase 2 (Arabidopsis)
Rat(303592) tousled-like kinase 2
Zebrafish(407732) tousled-like kinase 2
chicken(419949) tousled-like kinase 2
Horse(100054465) tousled-like kinase 2
domestic cat(101093158) tousled-like kinase 2
dog(490915) tousled-like kinase 2
domestic guinea pig(100732741) tousled-like kinase 2
Domestic Rabbit(100346656) tousled-like kinase 2
naked mole-rat(101697354) tousled-like kinase 2
cow(534705) tousled-like kinase 2
sheep(101122708) tousled-like kinase 2
158 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301763 Anti-TLK2 affinity isolated antibody human, mouse
immunohistochemistry pricing
T7327 Anti-TLK2 (362-375) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2102439 Anti-TLK2 antibody produced in rabbit affinity isolated antibody rabbit, bovine, guinea pig, rat, human, mouse, horse
western blot pricing
SAB4500192 Anti-TLK2 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
WH0011011M1 Monoclonal Anti-TLK2 antibody produced in mouse clone 2G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0177 Rabbit anti-TLK2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. horse, primate, pig, rhesus monkey, mouse, human, bovine, rabbit, guinea pig, rat, dog
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112707 Rosetta Predictions human pricing
NM_006852 Rosetta Predictions human pricing
XM_001067052 Rosetta Predictions rat pricing
XM_001081561 Rosetta Predictions rat pricing
XM_221023 Rosetta Predictions rat pricing
NM_001112705 Rosetta Predictions mouse pricing
NM_011903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325425 predicted 1640
2 SASI_Hs02_00325426 predicted 1635
3 SASI_Hs02_00325427 predicted 1793
4 SASI_Hs02_00325428 predicted 1390
5 SASI_Hs02_00325429 predicted 2113
6 SASI_Hs02_00325430 predicted 909
7 SASI_Hs02_00325431 predicted 1831
8 SASI_Hs02_00325432 predicted 1410
9 SASI_Hs02_00325433 predicted 1291
10 SASI_Hs02_00325434 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342457 predicted 1740
2 SASI_Hs01_00125101 predicted 1730
3 SASI_Hs01_00125102 predicted 1891
4 SASI_Hs01_00125104 predicted 1487
5 SASI_Hs01_00125105 predicted 2212
6 SASI_Hs01_00125106 predicted 1004
7 SASI_Hs02_00342458 predicted 1926
8 SASI_Hs01_00125108 predicted 1502
9 SASI_Hs02_00342459 predicted 1382
10 SASI_Hs01_00125109 predicted 1134
11 SASI_Hs01_00125103 predicted 1397
12 SASI_Hs01_00125107 predicted 552
13 SASI_Hs01_00125110 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319720 predicted 573
2 SASI_Rn02_00319721 predicted 1508
3 SASI_Rn02_00319722 predicted 1620
4 SASI_Rn02_00319723 predicted 1142
5 SASI_Rn02_00319724 predicted 1987
6 SASI_Rn02_00319725 predicted 1220
7 SASI_Rn02_00319726 predicted 1266
8 SASI_Rn02_00319727 predicted 1999
9 SASI_Rn02_00319728 predicted 1066
10 SASI_Rn02_00319729 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372428 predicted 1261
2 SASI_Rn02_00372429 predicted 2194
3 SASI_Rn02_00372430 predicted 1831
4 SASI_Rn02_00372431 predicted 2678
5 SASI_Rn02_00372432 predicted 1897
6 SASI_Rn02_00372433 predicted 900
7 SASI_Rn02_00372434 predicted 1950
8 SASI_Rn02_00372435 predicted 2684
9 SASI_Rn02_00372436 predicted 1745
10 SASI_Rn02_00372437 predicted 2203
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379754 predicted 1190
2 SASI_Rn02_00379755 predicted 2116
3 SASI_Rn02_00379756 predicted 1762
4 SASI_Rn02_00379757 predicted 2600
5 SASI_Rn02_00379758 predicted 1826
6 SASI_Rn02_00379759 predicted 827
7 SASI_Rn02_00379760 predicted 1876
8 SASI_Rn02_00379761 predicted 2619
9 SASI_Rn02_00379762 predicted 1673
10 SASI_Rn02_00379763 predicted 2127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306963 predicted 1185
2 SASI_Mm02_00306964 predicted 2553
3 SASI_Mm02_00306965 predicted 1874
4 SASI_Mm02_00306966 predicted 2669
5 SASI_Mm02_00306967 predicted 1682
6 SASI_Mm02_00306968 predicted 2157
7 SASI_Mm02_00306969 predicted 1316
8 SASI_Mm02_00306970 predicted 1298
9 SASI_Mm02_00306971 predicted 1397
10 SASI_Mm02_00306972 predicted 2172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321714 predicted 1090
2 SASI_Mm02_00321715 predicted 2454
3 SASI_Mm02_00321716 predicted 1774
4 SASI_Mm02_00321717 predicted 2575
5 SASI_Mm02_00321718 predicted 1583
6 SASI_Mm02_00321719 predicted 2061
7 SASI_Mm02_00321720 predicted 1219
8 SASI_Mm02_00321721 predicted 1204
9 SASI_Mm02_00321722 predicted 1307
10 SASI_Mm02_00321723 predicted 2075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006852
TLK2 MISSION shRNA Bacterial Glycerol Stock
tousled-like kinase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006852.2-2088s1c1
Sequence:CCGGCACAAGGTGCTGGTACTTATTCTCGAGAATAAGTACCAGCACCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006852.2-335s1c1
Sequence:CCGGCCACTTAATAGTGAGTCTTCCCTCGAGGGAAGACTCACTATTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-2138s1c1
Sequence:CCGGGCAAGACATCCTACAAGAGAACTCGAGTTCTCTTGTAGGATGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006852.x-2881s1c1
Sequence:CCGGTGGTGTTTGACTTCGGAGGAACTCGAGTTCCTCCGAAGTCAAACACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-1382s1c1
Sequence:CCGGTCTACATATCAGGGAACTAAACTCGAGTTTAGTTCCCTGATATGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-1496s1c1
Sequence:CCGGCAGTGAAGTTTACAAGGCATTCTCGAGAATGCCTTGTAAACTTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-1623s1c1
Sequence:CCGGCGGATTCATAAAGAGCTGGATCTCGAGATCCAGCTCTTTATGAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-2117s21c1
Sequence:CCGGGCTGGTACTTATTGGTATTTACTCGAGTAAATACCAATAAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-1741s21c1
Sequence:CCGGTAGGGAATACCGGATTCATAACTCGAGTTATGAATCCGGTATTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-1978s21c1
Sequence:CCGGTGACCTCAAACCAGGTAATATCTCGAGATATTACCTGGTTTGAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-595s21c1
Sequence:CCGGACGATCCTCACCGCAACATTCCTCGAGGAATGTTGCGGTGAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006852
TLK2 MISSION shRNA shRNA Plasmid DNA
tousled-like kinase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006852.2-2088s1c1
Sequence:CCGGCACAAGGTGCTGGTACTTATTCTCGAGAATAAGTACCAGCACCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006852.2-335s1c1
Sequence:CCGGCCACTTAATAGTGAGTCTTCCCTCGAGGGAAGACTCACTATTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-2138s1c1
Sequence:CCGGGCAAGACATCCTACAAGAGAACTCGAGTTCTCTTGTAGGATGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006852.x-2881s1c1
Sequence:CCGGTGGTGTTTGACTTCGGAGGAACTCGAGTTCCTCCGAAGTCAAACACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-1382s1c1
Sequence:CCGGTCTACATATCAGGGAACTAAACTCGAGTTTAGTTCCCTGATATGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-1496s1c1
Sequence:CCGGCAGTGAAGTTTACAAGGCATTCTCGAGAATGCCTTGTAAACTTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-1623s1c1
Sequence:CCGGCGGATTCATAAAGAGCTGGATCTCGAGATCCAGCTCTTTATGAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-2117s21c1
Sequence:CCGGGCTGGTACTTATTGGTATTTACTCGAGTAAATACCAATAAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-1741s21c1
Sequence:CCGGTAGGGAATACCGGATTCATAACTCGAGTTATGAATCCGGTATTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-1978s21c1
Sequence:CCGGTGACCTCAAACCAGGTAATATCTCGAGATATTACCTGGTTTGAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-595s21c1
Sequence:CCGGACGATCCTCACCGCAACATTCCTCGAGGAATGTTGCGGTGAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006852
TLK2 MISSION shRNA Lentiviral Transduction Particles
tousled-like kinase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006852.2-2088s1c1
Sequence:CCGGCACAAGGTGCTGGTACTTATTCTCGAGAATAAGTACCAGCACCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006852.2-335s1c1
Sequence:CCGGCCACTTAATAGTGAGTCTTCCCTCGAGGGAAGACTCACTATTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-2138s1c1
Sequence:CCGGGCAAGACATCCTACAAGAGAACTCGAGTTCTCTTGTAGGATGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006852.x-2881s1c1
Sequence:CCGGTGGTGTTTGACTTCGGAGGAACTCGAGTTCCTCCGAAGTCAAACACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-1382s1c1
Sequence:CCGGTCTACATATCAGGGAACTAAACTCGAGTTTAGTTCCCTGATATGTAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-1496s1c1
Sequence:CCGGCAGTGAAGTTTACAAGGCATTCTCGAGAATGCCTTGTAAACTTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006852.x-1623s1c1
Sequence:CCGGCGGATTCATAAAGAGCTGGATCTCGAGATCCAGCTCTTTATGAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-2117s21c1
Sequence:CCGGGCTGGTACTTATTGGTATTTACTCGAGTAAATACCAATAAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-1741s21c1
Sequence:CCGGTAGGGAATACCGGATTCATAACTCGAGTTATGAATCCGGTATTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-1978s21c1
Sequence:CCGGTGACCTCAAACCAGGTAATATCTCGAGATATTACCTGGTTTGAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006852.3-595s21c1
Sequence:CCGGACGATCCTCACCGCAACATTCCTCGAGGAATGTTGCGGTGAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011903
VALIDATED
TLK2 MISSION shRNA Bacterial Glycerol Stock
tousled-like kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011903.1-1612s1c1
Sequence:CCGGGCAACCAATGAGCAGAAACAACTCGAGTTGTTTCTGCTCATTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011903.1-1423s1c1
Sequence:CCGGCGATTGCGATTAGGCCACTTTCTCGAGAAAGTGGCCTAATCGCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011903.1-2653s1c1
Sequence:CCGGCGAAAGGAAGATCGCATTGATCTCGAGATCAATGCGATCTTCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011903.1-2182s1c1
Sequence:CCGGCGATCCATTATTATGCAGATTCTCGAGAATCTGCATAATAATGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011903.1-2496s1c1
Sequence:CCGGCCAGTGTCTTTATGGGAGGAACTCGAGTTCCTCCCATAAAGACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011903.3-2535s21c1
Sequence:CCGGCGAAAGGAAGATCGCATTGATCTCGAGATCAATGCGATCTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011903.3-1494s21c1
Sequence:CCGGGCAACCAATGAGCAGAAACAACTCGAGTTGTTTCTGCTCATTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011903.3-1305s21c1
Sequence:CCGGCGATTGCGATTAGGCCACTTTCTCGAGAAAGTGGCCTAATCGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011903.3-2274s21c1
Sequence:CCGGGCTGGTACTTATTGGTATTTACTCGAGTAAATACCAATAAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011903
VALIDATED
TLK2 MISSION shRNA shRNA Plasmid DNA
tousled-like kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011903.1-1612s1c1
Sequence:CCGGGCAACCAATGAGCAGAAACAACTCGAGTTGTTTCTGCTCATTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011903.1-1423s1c1
Sequence:CCGGCGATTGCGATTAGGCCACTTTCTCGAGAAAGTGGCCTAATCGCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011903.1-2653s1c1
Sequence:CCGGCGAAAGGAAGATCGCATTGATCTCGAGATCAATGCGATCTTCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011903.1-2182s1c1
Sequence:CCGGCGATCCATTATTATGCAGATTCTCGAGAATCTGCATAATAATGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011903.1-2496s1c1
Sequence:CCGGCCAGTGTCTTTATGGGAGGAACTCGAGTTCCTCCCATAAAGACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011903.3-2535s21c1
Sequence:CCGGCGAAAGGAAGATCGCATTGATCTCGAGATCAATGCGATCTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011903.3-1494s21c1
Sequence:CCGGGCAACCAATGAGCAGAAACAACTCGAGTTGTTTCTGCTCATTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011903.3-1305s21c1
Sequence:CCGGCGATTGCGATTAGGCCACTTTCTCGAGAAAGTGGCCTAATCGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011903.3-2274s21c1
Sequence:CCGGGCTGGTACTTATTGGTATTTACTCGAGTAAATACCAATAAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011903
VALIDATED
TLK2 MISSION shRNA Lentiviral Transduction Particles
tousled-like kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011903.1-1612s1c1
Sequence:CCGGGCAACCAATGAGCAGAAACAACTCGAGTTGTTTCTGCTCATTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011903.1-1423s1c1
Sequence:CCGGCGATTGCGATTAGGCCACTTTCTCGAGAAAGTGGCCTAATCGCAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011903.1-2653s1c1
Sequence:CCGGCGAAAGGAAGATCGCATTGATCTCGAGATCAATGCGATCTTCCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011903.1-2182s1c1
Sequence:CCGGCGATCCATTATTATGCAGATTCTCGAGAATCTGCATAATAATGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011903.1-2496s1c1
Sequence:CCGGCCAGTGTCTTTATGGGAGGAACTCGAGTTCCTCCCATAAAGACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011903.3-2535s21c1
Sequence:CCGGCGAAAGGAAGATCGCATTGATCTCGAGATCAATGCGATCTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011903.3-1494s21c1
Sequence:CCGGGCAACCAATGAGCAGAAACAACTCGAGTTGTTTCTGCTCATTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011903.3-1305s21c1
Sequence:CCGGCGATTGCGATTAGGCCACTTTCTCGAGAAAGTGGCCTAATCGCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011903.3-2274s21c1
Sequence:CCGGGCTGGTACTTATTGGTATTTACTCGAGTAAATACCAATAAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks