EMAIL THIS PAGE TO A FRIEND

TLL1

tolloid-like 1

Synonyms: ASD6 TLL
UniProtKB ID: O43897, B2RMU2, Q96AN3, Q9NQS4
Gene ID:
Human(7092) Summary: This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(21892) tolloid-like
Rat(678743) tolloid-like 1
Thale Cress(841089) triacylglycerol lipase-like 1
Zebrafish(474335) tolloid-like 1
chicken(395441) tolloid-like 1
Horse(100061477) tolloid-like 1
domestic cat(101096723) tolloid-like 1
dog(482674) tolloid-like 1
cow(616468) tolloid-like 1
sheep(101122135) tolloid-like 1
naked mole-rat(101717981) tolloid-like 1
264 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012464 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009390 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009390 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009390 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060871 MISSION® esiRNA esiRNA targeting mouse Tll1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012464 Rosetta Predictions human pricing
NM_001106081 Rosetta Predictions rat pricing
XR_005487 Rosetta Predictions rat pricing
NM_009390 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042602 predicted 1086
2 SASI_Hs01_00042603 predicted 3120
3 SASI_Hs02_00344377 predicted 2715
4 SASI_Hs01_00042606 predicted 3343
5 SASI_Hs01_00042607 predicted 2180
6 SASI_Hs01_00042608 predicted 1656
7 SASI_Hs02_00344378 predicted 3497
8 SASI_Hs01_00042609 predicted 2892
9 SASI_Hs01_00042611 predicted 799
10 SASI_Hs02_00344379 predicted 1745
11 SASI_Hs01_00042604 predicted 1043
12 SASI_Hs01_00042605 predicted 2559
13 SASI_Hs01_00042610 predicted 2968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215442 predicted 2736
2 SASI_Rn02_00215443 predicted 930
3 SASI_Rn02_00215444 predicted 1642
4 SASI_Rn02_00215445 predicted 2808
5 SASI_Rn02_00215446 predicted 1925
6 SASI_Rn02_00215447 predicted 3196
7 SASI_Rn02_00215448 predicted 1951
8 SASI_Rn02_00215449 predicted 2619
9 SASI_Rn02_00215450 predicted 3444
10 SASI_Rn02_00215451 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409477 predicted 3895
2 SASI_Rn02_00409478 predicted 3847
3 SASI_Rn02_00409479 predicted 3853
4 SASI_Rn02_00409480 predicted 3840
5 SASI_Rn02_00409481 predicted 3851
6 SASI_Rn02_00409482 predicted 3887
7 SASI_Rn02_00409483 predicted 3872
8 SASI_Rn02_00409484 predicted 3690
9 SASI_Rn02_00409485 predicted 3764
10 SASI_Rn02_00409486 predicted 4438
11 SASI_Rn01_00183938 predicted 934
12 SASI_Rn01_00183939 predicted 1117
13 SASI_Rn01_00183940 predicted 2066
14 SASI_Rn01_00183941 predicted 1214
15 SASI_Rn01_00183942 predicted 1412
16 SASI_Rn01_00183943 predicted 952
17 SASI_Rn01_00183944 predicted 1303
18 SASI_Rn01_00183945 predicted 1068
19 SASI_Rn01_00183946 predicted 1217
20 SASI_Rn01_00183947 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316007 predicted 2359
2 SASI_Mm02_00316008 predicted 1881
3 SASI_Mm02_00316009 predicted 2696
4 SASI_Mm01_00111543 predicted 3144
5 SASI_Mm02_00316010 predicted 1826
6 SASI_Mm01_00111544 predicted 2752
7 SASI_Mm01_00111545 predicted 2614
8 SASI_Mm01_00111546 predicted 1564
9 SASI_Mm02_00316011 predicted 933
10 SASI_Mm01_00111548 predicted 928
11 SASI_Mm01_00111540 predicted 1524
12 SASI_Mm01_00111541 predicted 2706
13 SASI_Mm01_00111542 predicted 2755
14 SASI_Mm01_00111547 predicted 2689
15 SASI_Mm01_00111549 predicted 1917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012464
TLL1 MISSION shRNA Bacterial Glycerol Stock
tolloid-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012464.3-4140s21c1
Sequence:CCGGGTGTAAACCAGATCCATATAACTCGAGTTATATGGATCTGGTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012464.3-1113s21c1
Sequence:CCGGATATGGCCTGGAGGCGTTATTCTCGAGAATAACGCCTCCAGGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012464.3-1848s21c1
Sequence:CCGGTTGTGCTGGTATGACTATATTCTCGAGAATATAGTCATACCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012464.3-3886s21c1
Sequence:CCGGTCCATGCTTGATGGTATTAATCTCGAGATTAATACCATCAAGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-1090s1c1
Sequence:CCGGCCGCTACATCAAGAACGGAAACTCGAGTTTCCGTTCTTGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-2756s1c1
Sequence:CCGGCCAGTTCAACAATATGAGAATCTCGAGATTCTCATATTGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-3090s1c1
Sequence:CCGGGCCTTTAGTGAATTTGAGATTCTCGAGAATCTCAAATTCACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-837s1c1
Sequence:CCGGGCCTTAGATGATGAAGACTTACTCGAGTAAGTCTTCATCATCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012464
TLL1 MISSION shRNA shRNA Plasmid DNA
tolloid-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012464.3-4140s21c1
Sequence:CCGGGTGTAAACCAGATCCATATAACTCGAGTTATATGGATCTGGTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012464.3-1113s21c1
Sequence:CCGGATATGGCCTGGAGGCGTTATTCTCGAGAATAACGCCTCCAGGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012464.3-1848s21c1
Sequence:CCGGTTGTGCTGGTATGACTATATTCTCGAGAATATAGTCATACCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012464.3-3886s21c1
Sequence:CCGGTCCATGCTTGATGGTATTAATCTCGAGATTAATACCATCAAGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-1090s1c1
Sequence:CCGGCCGCTACATCAAGAACGGAAACTCGAGTTTCCGTTCTTGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-2756s1c1
Sequence:CCGGCCAGTTCAACAATATGAGAATCTCGAGATTCTCATATTGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-3090s1c1
Sequence:CCGGGCCTTTAGTGAATTTGAGATTCTCGAGAATCTCAAATTCACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-837s1c1
Sequence:CCGGGCCTTAGATGATGAAGACTTACTCGAGTAAGTCTTCATCATCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012464
TLL1 MISSION shRNA Lentiviral Transduction Particles
tolloid-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012464.3-4140s21c1
Sequence:CCGGGTGTAAACCAGATCCATATAACTCGAGTTATATGGATCTGGTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012464.3-1113s21c1
Sequence:CCGGATATGGCCTGGAGGCGTTATTCTCGAGAATAACGCCTCCAGGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012464.3-1848s21c1
Sequence:CCGGTTGTGCTGGTATGACTATATTCTCGAGAATATAGTCATACCAGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012464.3-3886s21c1
Sequence:CCGGTCCATGCTTGATGGTATTAATCTCGAGATTAATACCATCAAGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-1090s1c1
Sequence:CCGGCCGCTACATCAAGAACGGAAACTCGAGTTTCCGTTCTTGATGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-2756s1c1
Sequence:CCGGCCAGTTCAACAATATGAGAATCTCGAGATTCTCATATTGTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-3090s1c1
Sequence:CCGGGCCTTTAGTGAATTTGAGATTCTCGAGAATCTCAAATTCACTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012464.3-837s1c1
Sequence:CCGGGCCTTAGATGATGAAGACTTACTCGAGTAAGTCTTCATCATCTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009390
TLL1 MISSION shRNA Bacterial Glycerol Stock
tolloid-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-3041s1c1
Sequence:CCGGCGCATCACATTAGCCTTCAATCTCGAGATTGAAGGCTAATGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-2879s1c1
Sequence:CCGGCGGAATGGATTCGTGTTGCATCTCGAGATGCAACACGAATCCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-2126s1c1
Sequence:CCGGGCCTTTGAGATCGAAAGACATCTCGAGATGTCTTTCGATCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-699s1c1
Sequence:CCGGGCCTCGATTATGATTACACTTCTCGAGAAGTGTAATCATAATCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-1601s1c1
Sequence:CCGGCGGTTAAGCAAAGGAGACATTCTCGAGAATGTCTCCTTTGCTTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009390
TLL1 MISSION shRNA shRNA Plasmid DNA
tolloid-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-3041s1c1
Sequence:CCGGCGCATCACATTAGCCTTCAATCTCGAGATTGAAGGCTAATGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-2879s1c1
Sequence:CCGGCGGAATGGATTCGTGTTGCATCTCGAGATGCAACACGAATCCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-2126s1c1
Sequence:CCGGGCCTTTGAGATCGAAAGACATCTCGAGATGTCTTTCGATCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-699s1c1
Sequence:CCGGGCCTCGATTATGATTACACTTCTCGAGAAGTGTAATCATAATCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-1601s1c1
Sequence:CCGGCGGTTAAGCAAAGGAGACATTCTCGAGAATGTCTCCTTTGCTTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009390
TLL1 MISSION shRNA Lentiviral Transduction Particles
tolloid-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-3041s1c1
Sequence:CCGGCGCATCACATTAGCCTTCAATCTCGAGATTGAAGGCTAATGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-2879s1c1
Sequence:CCGGCGGAATGGATTCGTGTTGCATCTCGAGATGCAACACGAATCCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-2126s1c1
Sequence:CCGGGCCTTTGAGATCGAAAGACATCTCGAGATGTCTTTCGATCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-699s1c1
Sequence:CCGGGCCTCGATTATGATTACACTTCTCGAGAAGTGTAATCATAATCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009390.1-1601s1c1
Sequence:CCGGCGGTTAAGCAAAGGAGACATTCTCGAGAATGTCTCCTTTGCTTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks