EMAIL THIS PAGE TO A FRIEND

TLL2

tolloid-like 2

UniProtKB ID: Q9Y6L7, A6NDK0, Q2M1H1, Q6PJN5, Q9UQ00
Gene ID:
Human(7093) Summary: This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
Mouse(24087) tolloid-like 2
Rat(365460) tolloid-like 2
naked mole-rat(101713756) tolloid-like 2
cow(504975) tolloid-like 2
sheep(101107749) tolloid-like 2
chicken(423754) tolloid-like 2
Horse(100070823) tolloid-like 2
domestic cat(101086678) tolloid-like 2
dog(486816) tolloid-like 2
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012465 Rosetta Predictions human pricing
XM_001054070 Rosetta Predictions rat pricing
XM_345031 Rosetta Predictions rat pricing
NM_011904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092457 predicted 1731
2 SASI_Hs01_00092458 predicted 1643
3 SASI_Hs01_00092459 predicted 1387
4 SASI_Hs01_00092460 predicted 1685
5 SASI_Hs01_00092461 predicted 512
6 SASI_Hs02_00344380 predicted 2207
7 SASI_Hs01_00092462 predicted 388
8 SASI_Hs01_00092463 predicted 1638
9 SASI_Hs01_00092464 predicted 1855
10 SASI_Hs01_00092465 predicted 715
11 SASI_Hs01_00092456 predicted 2135
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274590 predicted 430
2 SASI_Rn02_00274591 predicted 513
3 SASI_Rn02_00274592 predicted 2646
4 SASI_Rn02_00274593 predicted 2235
5 SASI_Rn02_00274594 predicted 1722
6 SASI_Rn02_00274595 predicted 1657
7 SASI_Rn02_00274596 predicted 2918
8 SASI_Rn02_00274597 predicted 2252
9 SASI_Rn02_00274598 predicted 1775
10 SASI_Rn02_00274599 predicted 1899
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397871 predicted 428
2 SASI_Rn02_00397872 predicted 506
3 SASI_Rn02_00397873 predicted 2644
4 SASI_Rn02_00397874 predicted 2234
5 SASI_Rn02_00397875 predicted 1726
6 SASI_Rn02_00397876 predicted 1664
7 SASI_Rn02_00397877 predicted 2915
8 SASI_Rn02_00397878 predicted 2249
9 SASI_Rn02_00397879 predicted 1783
10 SASI_Rn02_00397880 predicted 1898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113135 predicted 1663
2 SASI_Mm02_00321724 predicted 309
3 SASI_Mm02_00321725 predicted 332
4 SASI_Mm01_00113136 predicted 2122
5 SASI_Mm01_00113137 predicted 1722
6 SASI_Mm01_00113138 predicted 2126
7 SASI_Mm01_00113140 predicted 3110
8 SASI_Mm01_00113141 predicted 438
9 SASI_Mm02_00321726 predicted 3058
10 SASI_Mm01_00113142 predicted 3090
11 SASI_Mm01_00113139 predicted 3328
12 SASI_Mm01_00113143 predicted 780
13 SASI_Mm01_00113144 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012465
TLL2 MISSION shRNA Bacterial Glycerol Stock
tolloid-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-2057s1c1
Sequence:CCGGGCCGATAAGAAGATGTGTGAACTCGAGTTCACACATCTTCTTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-3161s1c1
Sequence:CCGGGCAGGTGATTCCCTGATGATTCTCGAGAATCATCAGGGAATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-1642s1c1
Sequence:CCGGCGGTCAGATTCAATCTCCCAACTCGAGTTGGGAGATTGAATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-2089s1c1
Sequence:CCGGCGGTTTCATTACCAAGCTGAACTCGAGTTCAGCTTGGTAATGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-2659s1c1
Sequence:CCGGCCACAGAGTGAAACTCACCTTCTCGAGAAGGTGAGTTTCACTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012465.2-2238s21c1
Sequence:CCGGACGTCTGTAAGTACGACTTTGCTCGAGCAAAGTCGTACTTACAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012465.2-821s21c1
Sequence:CCGGACGGATGAGGAAAGCTTTATTCTCGAGAATAAAGCTTTCCTCATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012465.2-2135s21c1
Sequence:CCGGCCGAAGGAGTATCCCACAAACCTCGAGGTTTGTGGGATACTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012465
TLL2 MISSION shRNA shRNA Plasmid DNA
tolloid-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-2057s1c1
Sequence:CCGGGCCGATAAGAAGATGTGTGAACTCGAGTTCACACATCTTCTTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-3161s1c1
Sequence:CCGGGCAGGTGATTCCCTGATGATTCTCGAGAATCATCAGGGAATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-1642s1c1
Sequence:CCGGCGGTCAGATTCAATCTCCCAACTCGAGTTGGGAGATTGAATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-2089s1c1
Sequence:CCGGCGGTTTCATTACCAAGCTGAACTCGAGTTCAGCTTGGTAATGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-2659s1c1
Sequence:CCGGCCACAGAGTGAAACTCACCTTCTCGAGAAGGTGAGTTTCACTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012465.2-2238s21c1
Sequence:CCGGACGTCTGTAAGTACGACTTTGCTCGAGCAAAGTCGTACTTACAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012465.2-821s21c1
Sequence:CCGGACGGATGAGGAAAGCTTTATTCTCGAGAATAAAGCTTTCCTCATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012465.2-2135s21c1
Sequence:CCGGCCGAAGGAGTATCCCACAAACCTCGAGGTTTGTGGGATACTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012465
TLL2 MISSION shRNA Lentiviral Transduction Particles
tolloid-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-2057s1c1
Sequence:CCGGGCCGATAAGAAGATGTGTGAACTCGAGTTCACACATCTTCTTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-3161s1c1
Sequence:CCGGGCAGGTGATTCCCTGATGATTCTCGAGAATCATCAGGGAATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-1642s1c1
Sequence:CCGGCGGTCAGATTCAATCTCCCAACTCGAGTTGGGAGATTGAATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-2089s1c1
Sequence:CCGGCGGTTTCATTACCAAGCTGAACTCGAGTTCAGCTTGGTAATGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012465.2-2659s1c1
Sequence:CCGGCCACAGAGTGAAACTCACCTTCTCGAGAAGGTGAGTTTCACTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012465.2-2238s21c1
Sequence:CCGGACGTCTGTAAGTACGACTTTGCTCGAGCAAAGTCGTACTTACAGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012465.2-821s21c1
Sequence:CCGGACGGATGAGGAAAGCTTTATTCTCGAGAATAAAGCTTTCCTCATCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012465.2-2135s21c1
Sequence:CCGGCCGAAGGAGTATCCCACAAACCTCGAGGTTTGTGGGATACTCCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011904
TLL2 MISSION shRNA Bacterial Glycerol Stock
tolloid-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-499s1c1
Sequence:CCGGGCCAAACGATACAGCCTCTAACTCGAGTTAGAGGCTGTATCGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-2578s1c1
Sequence:CCGGGAAGGAATGTACCTGGAACATCTCGAGATGTTCCAGGTACATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-2975s1c1
Sequence:CCGGGAGCTGATATTCCGGACCTTTCTCGAGAAAGGTCCGGAATATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-1393s1c1
Sequence:CCGGCTGGTACGATTACGTGGAGATCTCGAGATCTCCACGTAATCGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-1868s1c1
Sequence:CCGGTCCATCAATAAAGCGGGCTTTCTCGAGAAAGCCCGCTTTATTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011904
TLL2 MISSION shRNA shRNA Plasmid DNA
tolloid-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-499s1c1
Sequence:CCGGGCCAAACGATACAGCCTCTAACTCGAGTTAGAGGCTGTATCGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-2578s1c1
Sequence:CCGGGAAGGAATGTACCTGGAACATCTCGAGATGTTCCAGGTACATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-2975s1c1
Sequence:CCGGGAGCTGATATTCCGGACCTTTCTCGAGAAAGGTCCGGAATATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-1393s1c1
Sequence:CCGGCTGGTACGATTACGTGGAGATCTCGAGATCTCCACGTAATCGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-1868s1c1
Sequence:CCGGTCCATCAATAAAGCGGGCTTTCTCGAGAAAGCCCGCTTTATTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011904
TLL2 MISSION shRNA Lentiviral Transduction Particles
tolloid-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-499s1c1
Sequence:CCGGGCCAAACGATACAGCCTCTAACTCGAGTTAGAGGCTGTATCGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-2578s1c1
Sequence:CCGGGAAGGAATGTACCTGGAACATCTCGAGATGTTCCAGGTACATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-2975s1c1
Sequence:CCGGGAGCTGATATTCCGGACCTTTCTCGAGAAAGGTCCGGAATATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-1393s1c1
Sequence:CCGGCTGGTACGATTACGTGGAGATCTCGAGATCTCCACGTAATCGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011904.1-1868s1c1
Sequence:CCGGTCCATCAATAAAGCGGGCTTTCTCGAGAAAGCCCGCTTTATTGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks