EMAIL THIS PAGE TO A FRIEND

TLN1

talin 1

Synonyms: ILWEQ TLN
UniProtKB ID: Q9Y490, A6NMY0, Q86YD0, Q9NZQ2, Q9UHH8, Q9UPX3
Gene ID:
Human(7094) Summary: This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
Mouse(21894) talin 1
Rat(313494) talin 1
cow(783470) talin 1
dog(474759) talin 1
chicken(395194) talin 1
Gene Class: Cytoskeleton
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006289 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006289 Rosetta Predictions human pricing
NM_001039025 Rosetta Predictions rat pricing
XM_001053379 Rosetta Predictions rat pricing
XM_001069865 Rosetta Predictions rat pricing
NM_011602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226540 predicted 6596
2 SASI_Hs01_00226541 predicted 6328
3 SASI_Hs01_00226542 predicted 5581
4 SASI_Hs01_00226543 predicted 5740
5 SASI_Hs02_00341278 predicted 5080
6 SASI_Hs01_00226544 predicted 401
7 SASI_Hs02_00341279 predicted 5935
8 SASI_Hs01_00226545 predicted 1661
9 SASI_Hs02_00341280 predicted 7105
10 SASI_Hs01_00226547 predicted 2790
11 SASI_Hs01_00226546 predicted 5708
12 SASI_Hs01_00226548 predicted 5822
13 SASI_Hs01_00226549 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204763 predicted 6740
2 SASI_Rn02_00204764 predicted 6932
3 SASI_Rn02_00204765 predicted 1689
4 SASI_Rn02_00204766 predicted 8157
5 SASI_Rn02_00204767 predicted 4494
6 SASI_Rn02_00204768 predicted 6111
7 SASI_Rn02_00204769 predicted 918
8 SASI_Rn02_00204770 predicted 5433
9 SASI_Rn02_00204771 predicted 1579
10 SASI_Rn02_00204772 predicted 6075
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272142 predicted 6321
2 SASI_Rn02_00272143 predicted 6517
3 SASI_Rn02_00272144 predicted 7746
4 SASI_Rn02_00272145 predicted 4086
5 SASI_Rn02_00272146 predicted 5699
6 SASI_Rn02_00272147 predicted 5022
7 SASI_Rn02_00272148 predicted 5665
8 SASI_Rn02_00272149 predicted 4317
9 SASI_Rn02_00272150 predicted 3797
10 SASI_Rn02_00272151 predicted 5351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329647 predicted 6329
2 SASI_Rn02_00329648 predicted 6513
3 SASI_Rn02_00329649 predicted 1281
4 SASI_Rn02_00329650 predicted 7754
5 SASI_Rn02_00329651 predicted 4084
6 SASI_Rn02_00329652 predicted 5701
7 SASI_Rn02_00329653 predicted 507
8 SASI_Rn02_00329654 predicted 5017
9 SASI_Rn02_00329655 predicted 1162
10 SASI_Rn02_00329656 predicted 5670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114842 predicted 6668
2 SASI_Mm01_00114843 predicted 6953
3 SASI_Mm01_00114844 predicted 7377
4 SASI_Mm01_00114845 predicted 5657
5 SASI_Mm01_00114846 predicted 7743
6 SASI_Mm01_00114847 predicted 2559
7 SASI_Mm01_00114848 predicted 6000
8 SASI_Mm01_00114849 predicted 5349
9 SASI_Mm01_00114850 predicted 217
10 SASI_Mm01_00114851 predicted 6686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006289
VALIDATED
TLN1 MISSION shRNA Bacterial Glycerol Stock
talin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006289.2-7937s1c1
Sequence:CCGGCCCAGAGTATTAACGCTCCAACTCGAGTTGGAGCGTTAATACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006289.2-6337s1c1
Sequence:CCGGGCAGTGAAAGATGTAGCCAAACTCGAGTTTGGCTACATCTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006289.2-442s1c1
Sequence:CCGGCGCATTGGCATCACCAATCATCTCGAGATGATTGGTGATGCCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006289.2-5636s1c1
Sequence:CCGGCCTTCGTGGATTACCAAACAACTCGAGTTGTTTGGTAATCCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006289.2-7486s1c1
Sequence:CCGGGCCTCAGATAATCTGGTGAAACTCGAGTTTCACCAGATTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-706s21c1
Sequence:CCGGCGCATTGGCATCACCAATCATCTCGAGATGATTGGTGATGCCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-8201s21c1
Sequence:CCGGCCCAGAGTATTAACGCTCCAACTCGAGTTGGAGCGTTAATACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-6601s21c1
Sequence:CCGGGCAGTGAAAGATGTAGCCAAACTCGAGTTTGGCTACATCTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-7750s21c1
Sequence:CCGGGCCTCAGATAATCTGGTGAAACTCGAGTTTCACCAGATTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-5900s21c1
Sequence:CCGGCCTTCGTGGATTACCAAACAACTCGAGTTGTTTGGTAATCCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006289
VALIDATED
TLN1 MISSION shRNA shRNA Plasmid DNA
talin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006289.2-7937s1c1
Sequence:CCGGCCCAGAGTATTAACGCTCCAACTCGAGTTGGAGCGTTAATACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006289.2-6337s1c1
Sequence:CCGGGCAGTGAAAGATGTAGCCAAACTCGAGTTTGGCTACATCTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006289.2-442s1c1
Sequence:CCGGCGCATTGGCATCACCAATCATCTCGAGATGATTGGTGATGCCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006289.2-5636s1c1
Sequence:CCGGCCTTCGTGGATTACCAAACAACTCGAGTTGTTTGGTAATCCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006289.2-7486s1c1
Sequence:CCGGGCCTCAGATAATCTGGTGAAACTCGAGTTTCACCAGATTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-706s21c1
Sequence:CCGGCGCATTGGCATCACCAATCATCTCGAGATGATTGGTGATGCCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-8201s21c1
Sequence:CCGGCCCAGAGTATTAACGCTCCAACTCGAGTTGGAGCGTTAATACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-6601s21c1
Sequence:CCGGGCAGTGAAAGATGTAGCCAAACTCGAGTTTGGCTACATCTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-7750s21c1
Sequence:CCGGGCCTCAGATAATCTGGTGAAACTCGAGTTTCACCAGATTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-5900s21c1
Sequence:CCGGCCTTCGTGGATTACCAAACAACTCGAGTTGTTTGGTAATCCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006289
VALIDATED
TLN1 MISSION shRNA Lentiviral Transduction Particles
talin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006289.2-7937s1c1
Sequence:CCGGCCCAGAGTATTAACGCTCCAACTCGAGTTGGAGCGTTAATACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_006289.2-6337s1c1
Sequence:CCGGGCAGTGAAAGATGTAGCCAAACTCGAGTTTGGCTACATCTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006289.2-442s1c1
Sequence:CCGGCGCATTGGCATCACCAATCATCTCGAGATGATTGGTGATGCCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006289.2-5636s1c1
Sequence:CCGGCCTTCGTGGATTACCAAACAACTCGAGTTGTTTGGTAATCCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006289.2-7486s1c1
Sequence:CCGGGCCTCAGATAATCTGGTGAAACTCGAGTTTCACCAGATTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-706s21c1
Sequence:CCGGCGCATTGGCATCACCAATCATCTCGAGATGATTGGTGATGCCAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-8201s21c1
Sequence:CCGGCCCAGAGTATTAACGCTCCAACTCGAGTTGGAGCGTTAATACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-6601s21c1
Sequence:CCGGGCAGTGAAAGATGTAGCCAAACTCGAGTTTGGCTACATCTTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-7750s21c1
Sequence:CCGGGCCTCAGATAATCTGGTGAAACTCGAGTTTCACCAGATTATCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006289.3-5900s21c1
Sequence:CCGGCCTTCGTGGATTACCAAACAACTCGAGTTGTTTGGTAATCCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011602
VALIDATED
TLN1 MISSION shRNA Bacterial Glycerol Stock
talin 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011602.3-7207s1c1
Sequence:CCGGGCCACCAACAATCTGTGTGAACTCGAGTTCACACAGATTGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011602.3-4791s1c1
Sequence:CCGGGCCCATTGTAATCTCTGCTAACTCGAGTTAGCAGAGATTACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011602.3-7859s1c1
Sequence:CCGGCGCTCCAAGAGTATTATTAATCTCGAGATTAATAATACTCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011602.5-7014s21c1
Sequence:CCGGTCCGAATGACCAAGGGTATTACTCGAGTAATACCCTTGGTCATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-1967s21c1
Sequence:CCGGGCGCTCACTGGAACCATTAACCTCGAGGTTAATGGTTCCAGTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-8346s21c1
Sequence:CCGGCGCTCCAAGAGTATTATTAATCTCGAGATTAATAATACTCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-5278s21c1
Sequence:CCGGGCCCATTGTAATCTCTGCTAACTCGAGTTAGCAGAGATTACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-525s21c1
Sequence:CCGGTGGTGAAGACGATGCAATTTGCTCGAGCAAATTGCATCGTCTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011602
VALIDATED
TLN1 MISSION shRNA shRNA Plasmid DNA
talin 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011602.3-7207s1c1
Sequence:CCGGGCCACCAACAATCTGTGTGAACTCGAGTTCACACAGATTGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011602.3-4791s1c1
Sequence:CCGGGCCCATTGTAATCTCTGCTAACTCGAGTTAGCAGAGATTACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011602.3-7859s1c1
Sequence:CCGGCGCTCCAAGAGTATTATTAATCTCGAGATTAATAATACTCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011602.5-7014s21c1
Sequence:CCGGTCCGAATGACCAAGGGTATTACTCGAGTAATACCCTTGGTCATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-1967s21c1
Sequence:CCGGGCGCTCACTGGAACCATTAACCTCGAGGTTAATGGTTCCAGTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-8346s21c1
Sequence:CCGGCGCTCCAAGAGTATTATTAATCTCGAGATTAATAATACTCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-5278s21c1
Sequence:CCGGGCCCATTGTAATCTCTGCTAACTCGAGTTAGCAGAGATTACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-525s21c1
Sequence:CCGGTGGTGAAGACGATGCAATTTGCTCGAGCAAATTGCATCGTCTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011602
VALIDATED
TLN1 MISSION shRNA Lentiviral Transduction Particles
talin 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011602.3-7207s1c1
Sequence:CCGGGCCACCAACAATCTGTGTGAACTCGAGTTCACACAGATTGTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011602.3-4791s1c1
Sequence:CCGGGCCCATTGTAATCTCTGCTAACTCGAGTTAGCAGAGATTACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108755    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011602.3-7859s1c1
Sequence:CCGGCGCTCCAAGAGTATTATTAATCTCGAGATTAATAATACTCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011602.5-7014s21c1
Sequence:CCGGTCCGAATGACCAAGGGTATTACTCGAGTAATACCCTTGGTCATTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-1967s21c1
Sequence:CCGGGCGCTCACTGGAACCATTAACCTCGAGGTTAATGGTTCCAGTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-8346s21c1
Sequence:CCGGCGCTCCAAGAGTATTATTAATCTCGAGATTAATAATACTCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-5278s21c1
Sequence:CCGGGCCCATTGTAATCTCTGCTAACTCGAGTTAGCAGAGATTACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011602.5-525s21c1
Sequence:CCGGTGGTGAAGACGATGCAATTTGCTCGAGCAAATTGCATCGTCTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks