EMAIL THIS PAGE TO A FRIEND

TLN2

talin 2

Synonyms: ILWEQ
UniProtKB ID: Q9Y4G6, A6NLB8
Gene ID:
Human(83660) Summary: This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Mouse(70549) talin 2
Rat(315776) talin 2
chicken(415374) talin 2
dog(478331) talin 2
cow(528252) talin 2
Gene Class: Cytoskeleton
227 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22654 Anti-Talin-2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
T3287 Monoclonal Anti-Talin antibody produced in mouse clone 8d4, ascites fluid frog, mouse, rat, human, chicken
immunofluorescence, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015059 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015059 Rosetta Predictions human pricing
XM_001056519 Rosetta Predictions rat pricing
XM_001056578 Rosetta Predictions rat pricing
XM_001056646 Rosetta Predictions rat pricing
XM_001056698 Rosetta Predictions rat pricing
XM_236367 Rosetta Predictions rat pricing
NM_001081242 Rosetta Predictions mouse pricing
XM_486227 Rosetta Predictions mouse pricing
XM_891849 Rosetta Predictions mouse pricing
XM_899795 Rosetta Predictions mouse pricing
XM_899801 Rosetta Predictions mouse pricing
XM_899804 Rosetta Predictions mouse pricing
XM_899810 Rosetta Predictions mouse pricing
XM_988686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346913 predicted 4792
2 SASI_Hs01_00029751 predicted 3941
3 SASI_Hs01_00029752 predicted 4917
4 SASI_Hs02_00346914 predicted 4155
5 SASI_Hs01_00029753 predicted 5443
6 SASI_Hs01_00029754 predicted 453
7 SASI_Hs01_00029755 predicted 3447
8 SASI_Hs01_00029756 predicted 4214
9 SASI_Hs01_00029757 predicted 2495
10 SASI_Hs01_00029759 predicted 4146
11 SASI_Hs01_00029750 predicted 847
12 SASI_Hs01_00029758 predicted 5194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283486 predicted 3635
2 SASI_Rn02_00283487 predicted 368
3 SASI_Rn02_00283488 predicted 916
4 SASI_Rn02_00283489 predicted 749
5 SASI_Rn02_00283490 predicted 318
6 SASI_Rn02_00283491 predicted 4507
7 SASI_Rn02_00283492 predicted 1101
8 SASI_Rn02_00283493 predicted 4622
9 SASI_Rn02_00283494 predicted 1357
10 SASI_Rn02_00283495 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283694 predicted 3635
2 SASI_Rn02_00283695 predicted 366
3 SASI_Rn02_00283696 predicted 750
4 SASI_Rn02_00283697 predicted 319
5 SASI_Rn02_00283698 predicted 5598
6 SASI_Rn02_00283699 predicted 5717
7 SASI_Rn02_00283700 predicted 1350
8 SASI_Rn02_00283701 predicted 1300
9 SASI_Rn02_00283702 predicted 7084
10 SASI_Rn02_00283703 predicted 7651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283931 predicted 3711
2 SASI_Rn02_00283932 predicted 439
3 SASI_Rn02_00283933 predicted 824
4 SASI_Rn02_00283934 predicted 395
5 SASI_Rn02_00283935 predicted 5683
6 SASI_Rn02_00283936 predicted 5799
7 SASI_Rn02_00283937 predicted 1430
8 SASI_Rn02_00283938 predicted 1375
9 SASI_Rn02_00283939 predicted 7168
10 SASI_Rn02_00283940 predicted 7724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284112 predicted 3635
2 SASI_Rn02_00284113 predicted 359
3 SASI_Rn02_00284114 predicted 748
4 SASI_Rn02_00284115 predicted 313
5 SASI_Rn02_00284116 predicted 5601
6 SASI_Rn02_00284117 predicted 5723
7 SASI_Rn02_00284118 predicted 1350
8 SASI_Rn02_00284119 predicted 1306
9 SASI_Rn02_00284120 predicted 7087
10 SASI_Rn02_00284121 predicted 7657
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390024 predicted 3637
2 SASI_Rn02_00390025 predicted 365
3 SASI_Rn02_00390026 predicted 750
4 SASI_Rn02_00390027 predicted 321
5 SASI_Rn02_00390028 predicted 5605
6 SASI_Rn02_00390029 predicted 5719
7 SASI_Rn02_00390030 predicted 1351
8 SASI_Rn02_00390031 predicted 1300
9 SASI_Rn02_00390032 predicted 7089
10 SASI_Rn02_00390033 predicted 7692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296567 predicted 3658
2 SASI_Mm02_00296568 predicted 382
3 SASI_Mm02_00296569 predicted 2699
4 SASI_Mm02_00296570 predicted 6871
5 SASI_Mm02_00296571 predicted 3870
6 SASI_Mm02_00296572 predicted 936
7 SASI_Mm02_00296573 predicted 1378
8 SASI_Mm02_00296574 predicted 6800
9 SASI_Mm02_00296575 predicted 6716
10 SASI_Mm02_00296576 predicted 5744
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209543 predicted 3676
2 SASI_Mm01_00209544 predicted 2723
3 SASI_Mm01_00209545 predicted 6899
4 SASI_Mm01_00209546 predicted 3893
5 SASI_Mm01_00209547 predicted 6826
6 SASI_Mm01_00209548 predicted 6750
7 SASI_Mm01_00209549 predicted 6655
8 SASI_Mm01_00209550 predicted 2089
9 SASI_Mm01_00209551 predicted 1808
10 SASI_Mm01_00209552 predicted 7135
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229357 predicted 3631
2 SASI_Mm01_00229358 predicted 2681
3 SASI_Mm01_00229359 predicted 6844
4 SASI_Mm01_00229360 predicted 3854
5 SASI_Mm01_00229361 predicted 6782
6 SASI_Mm01_00229362 predicted 6699
7 SASI_Mm01_00229363 predicted 6609
8 SASI_Mm01_00229364 predicted 2048
9 SASI_Mm01_00229365 predicted 1765
10 SASI_Mm01_00229366 predicted 7085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267512 predicted 3640
2 SASI_Mm01_00267513 predicted 2677
3 SASI_Mm01_00267514 predicted 6850
4 SASI_Mm01_00267515 predicted 3852
5 SASI_Mm01_00267516 predicted 6776
6 SASI_Mm01_00267517 predicted 6706
7 SASI_Mm01_00267518 predicted 6616
8 SASI_Mm01_00267519 predicted 2040
9 SASI_Mm01_00267520 predicted 1767
10 SASI_Mm01_00267521 predicted 7094
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274413 predicted 3641
2 SASI_Mm01_00274414 predicted 2684
3 SASI_Mm01_00274415 predicted 5780
4 SASI_Mm01_00274416 predicted 3848
5 SASI_Mm01_00274417 predicted 5708
6 SASI_Mm01_00274418 predicted 5634
7 SASI_Mm01_00274419 predicted 5548
8 SASI_Mm01_00274420 predicted 2041
9 SASI_Mm01_00274421 predicted 1761
10 SASI_Mm01_00274422 predicted 6020
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212611 predicted 3567
2 SASI_Mm01_00212612 predicted 3493
3 SASI_Mm01_00212613 predicted 3842
4 SASI_Mm01_00212614 predicted 3419
5 SASI_Mm01_00212615 predicted 3327
6 SASI_Mm01_00212616 predicted 3799
7 SASI_Mm01_00212617 predicted 2556
8 SASI_Mm01_00212618 predicted 2676
9 SASI_Mm01_00212619 predicted 3930
10 SASI_Mm01_00212620 predicted 2883
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212780 predicted 3632
2 SASI_Mm01_00212781 predicted 2686
3 SASI_Mm01_00212782 predicted 6581
4 SASI_Mm01_00212783 predicted 3854
5 SASI_Mm01_00212784 predicted 6511
6 SASI_Mm01_00212785 predicted 6432
7 SASI_Mm01_00212786 predicted 6342
8 SASI_Mm01_00212787 predicted 2042
9 SASI_Mm01_00212788 predicted 1768
10 SASI_Mm01_00212789 predicted 6821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245410 predicted 3632
2 SASI_Mm01_00245411 predicted 2680
3 SASI_Mm01_00245412 predicted 5778
4 SASI_Mm01_00245413 predicted 3849
5 SASI_Mm01_00245414 predicted 5702
6 SASI_Mm01_00245415 predicted 5622
7 SASI_Mm01_00245416 predicted 5541
8 SASI_Mm01_00245417 predicted 2041
9 SASI_Mm01_00245418 predicted 1766
10 SASI_Mm01_00245419 predicted 6016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015059
TLN2 MISSION shRNA Bacterial Glycerol Stock
talin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015059.2-83s21c1
Sequence:CCGGACGATGCGTGTCGAGTCATTCCTCGAGGAATGACTCGACACGCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015059.2-1618s21c1
Sequence:CCGGGACGAATCCAAACACGAAATCCTCGAGGATTTCGTGTTTGGATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015059.1-7979s1c1
Sequence:CCGGCCTGGACCTCTTTATGATATTCTCGAGAATATCATAAAGAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-1262s1c1
Sequence:CCGGCCATGTTAGAAGAGTCCGTTTCTCGAGAAACGGACTCTTCTAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-53s1c1
Sequence:CCGGCCATGCAGTTTGAACCATCTACTCGAGTAGATGGTTCAAACTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-5533s1c1
Sequence:CCGGCCAGAACCAAAGGGAACATTTCTCGAGAAATGTTCCCTTTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-2545s1c1
Sequence:CCGGGCCGAAATCGACATGGAGAATCTCGAGATTCTCCATGTCGATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015059
TLN2 MISSION shRNA shRNA Plasmid DNA
talin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015059.2-83s21c1
Sequence:CCGGACGATGCGTGTCGAGTCATTCCTCGAGGAATGACTCGACACGCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015059.2-1618s21c1
Sequence:CCGGGACGAATCCAAACACGAAATCCTCGAGGATTTCGTGTTTGGATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015059.1-7979s1c1
Sequence:CCGGCCTGGACCTCTTTATGATATTCTCGAGAATATCATAAAGAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-1262s1c1
Sequence:CCGGCCATGTTAGAAGAGTCCGTTTCTCGAGAAACGGACTCTTCTAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-53s1c1
Sequence:CCGGCCATGCAGTTTGAACCATCTACTCGAGTAGATGGTTCAAACTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-5533s1c1
Sequence:CCGGCCAGAACCAAAGGGAACATTTCTCGAGAAATGTTCCCTTTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-2545s1c1
Sequence:CCGGGCCGAAATCGACATGGAGAATCTCGAGATTCTCCATGTCGATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015059
TLN2 MISSION shRNA Lentiviral Transduction Particles
talin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015059.2-83s21c1
Sequence:CCGGACGATGCGTGTCGAGTCATTCCTCGAGGAATGACTCGACACGCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015059.2-1618s21c1
Sequence:CCGGGACGAATCCAAACACGAAATCCTCGAGGATTTCGTGTTTGGATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015059.1-7979s1c1
Sequence:CCGGCCTGGACCTCTTTATGATATTCTCGAGAATATCATAAAGAGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-1262s1c1
Sequence:CCGGCCATGTTAGAAGAGTCCGTTTCTCGAGAAACGGACTCTTCTAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-53s1c1
Sequence:CCGGCCATGCAGTTTGAACCATCTACTCGAGTAGATGGTTCAAACTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-5533s1c1
Sequence:CCGGCCAGAACCAAAGGGAACATTTCTCGAGAAATGTTCCCTTTGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015059.1-2545s1c1
Sequence:CCGGGCCGAAATCGACATGGAGAATCTCGAGATTCTCCATGTCGATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081242
TLN2 MISSION shRNA Bacterial Glycerol Stock
talin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-4867s21c1
Sequence:CCGGATCGCAATAAGTGTCGAATTGCTCGAGCAATTCGACACTTATTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-7774s21c1
Sequence:CCGGTCCGCCAGCAGCAGTACAAATCTCGAGATTTGTACTGCTGCTGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-1324s21c1
Sequence:CCGGAGTACCAAGAGAGCTACTATTCTCGAGAATAGTAGCTCTCTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081242.2-8676s21c1
Sequence:CCGGCCCATGTTCGAGCCCTATTATCTCGAGATAATAGGGCTCGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-1028s21c1
Sequence:CCGGAGGAGCCGAGAAGCGAATATTCTCGAGAATATTCGCTTCTCGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081242
TLN2 MISSION shRNA shRNA Plasmid DNA
talin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-4867s21c1
Sequence:CCGGATCGCAATAAGTGTCGAATTGCTCGAGCAATTCGACACTTATTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-7774s21c1
Sequence:CCGGTCCGCCAGCAGCAGTACAAATCTCGAGATTTGTACTGCTGCTGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-1324s21c1
Sequence:CCGGAGTACCAAGAGAGCTACTATTCTCGAGAATAGTAGCTCTCTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081242.2-8676s21c1
Sequence:CCGGCCCATGTTCGAGCCCTATTATCTCGAGATAATAGGGCTCGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-1028s21c1
Sequence:CCGGAGGAGCCGAGAAGCGAATATTCTCGAGAATATTCGCTTCTCGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081242
TLN2 MISSION shRNA Lentiviral Transduction Particles
talin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-4867s21c1
Sequence:CCGGATCGCAATAAGTGTCGAATTGCTCGAGCAATTCGACACTTATTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-7774s21c1
Sequence:CCGGTCCGCCAGCAGCAGTACAAATCTCGAGATTTGTACTGCTGCTGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-1324s21c1
Sequence:CCGGAGTACCAAGAGAGCTACTATTCTCGAGAATAGTAGCTCTCTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081242.2-8676s21c1
Sequence:CCGGCCCATGTTCGAGCCCTATTATCTCGAGATAATAGGGCTCGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081242.2-1028s21c1
Sequence:CCGGAGGAGCCGAGAAGCGAATATTCTCGAGAATATTCGCTTCTCGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks