EMAIL THIS PAGE TO A FRIEND

TLR10

toll-like receptor 10

Synonyms: CD290
Gene ID:
Human(81793) Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is most highly expressed in lymphoid tissues such as spleen, lymph node, thymus, and tonsil. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
Rat(305355) toll-like receptor 10
naked mole-rat(101726627) toll-like receptor 10
domestic guinea pig(100732578) toll-like receptor 10
cow(539791) toll-like receptor 10
Goat(100860933) toll-like receptor 10
sheep(554255) toll-like receptor 10
dog(100379585) toll-like receptor 10
domestic cat(101085543) toll-like receptor 10
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030956 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069711 MISSION® esiRNA esiRNA human TLR10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017388 Rosetta Predictions human pricing
NM_030956 Rosetta Predictions human pricing
XM_001078345 Rosetta Predictions rat pricing
XM_223422 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099892 predicted 777
2 SASI_Hs01_00099893 predicted 1504
3 SASI_Hs01_00099894 predicted 965
4 SASI_Hs01_00099895 predicted 1853
5 SASI_Hs01_00099896 predicted 1384
6 SASI_Hs01_00099897 predicted 430
7 SASI_Hs01_00099898 predicted 1263
8 SASI_Hs01_00099899 predicted 1801
9 SASI_Hs01_00099900 predicted 1204
10 SASI_Hs02_00306723 predicted 395
11 SASI_Hs01_00099901 predicted 1667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192568 predicted 1285
2 SASI_Hs01_00192569 predicted 2007
3 SASI_Hs01_00192570 predicted 1476
4 SASI_Hs01_00192571 predicted 2360
5 SASI_Hs01_00192572 predicted 1892
6 SASI_Hs01_00192573 predicted 929
7 SASI_Hs01_00192574 predicted 1770
8 SASI_Hs01_00192575 predicted 2310
9 SASI_Hs01_00192576 predicted 1709
10 SASI_Hs02_00358537 predicted 899
11 SASI_Hs01_00192577 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360474 predicted 1648
2 SASI_Rn02_00360475 predicted 229
3 SASI_Rn02_00360476 predicted 1703
4 SASI_Rn02_00360477 predicted 734
5 SASI_Rn02_00360478 predicted 1538
6 SASI_Rn02_00360479 predicted 591
7 SASI_Rn02_00360480 predicted 1067
8 SASI_Rn02_00360481 predicted 1553
9 SASI_Rn02_00360482 predicted 290
10 SASI_Rn02_00360483 predicted 1736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381359 predicted 1655
2 SASI_Rn02_00381360 predicted 233
3 SASI_Rn02_00381361 predicted 1700
4 SASI_Rn02_00381362 predicted 728
5 SASI_Rn02_00381363 predicted 1544
6 SASI_Rn02_00381364 predicted 598
7 SASI_Rn02_00381365 predicted 1074
8 SASI_Rn02_00381366 predicted 1559
9 SASI_Rn02_00381367 predicted 291
10 SASI_Rn02_00381368 predicted 1738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030956
TLR10 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-2886s21c1
Sequence:CCGGGGCCCAAGGATAGGCGTAAATCTCGAGATTTACGCCTATCCTTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-2313s21c1
Sequence:CCGGACGTTCATCTCCACGAATTATCTCGAGATAATTCGTGGAGATGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-1100s21c1
Sequence:CCGGATTGCTCATCTGCATCTAAATCTCGAGATTTAGATGCAGATGAGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-2509s21c1
Sequence:CCGGTGTCCGATTCCACGCATTTATCTCGAGATAAATGCGTGGAATCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-638s1c2
Sequence:CCGGCGACACTGGATTTATCCTATACTCGAGTATAGGATAAATCCAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-2215s1c1
Sequence:CCGGGCTCTGTTGATTGTCACCATTCTCGAGAATGGTGACAATCAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-1515s1c1
Sequence:CCGGCCCGAATTATCCTACGAAATTCTCGAGAATTTCGTAGGATAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-638s1c1
Sequence:CCGGCGACACTGGATTTATCCTATACTCGAGTATAGGATAAATCCAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-2058s1c1
Sequence:CCGGCCGGTGTACCTGTGAATTAAACTCGAGTTTAATTCACAGGTACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-2850s1c1
Sequence:CCGGGCAGACATTCACAGAGTTAAACTCGAGTTTAACTCTGTGAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030956
TLR10 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-2886s21c1
Sequence:CCGGGGCCCAAGGATAGGCGTAAATCTCGAGATTTACGCCTATCCTTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-2313s21c1
Sequence:CCGGACGTTCATCTCCACGAATTATCTCGAGATAATTCGTGGAGATGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-1100s21c1
Sequence:CCGGATTGCTCATCTGCATCTAAATCTCGAGATTTAGATGCAGATGAGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-2509s21c1
Sequence:CCGGTGTCCGATTCCACGCATTTATCTCGAGATAAATGCGTGGAATCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-638s1c2
Sequence:CCGGCGACACTGGATTTATCCTATACTCGAGTATAGGATAAATCCAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-2215s1c1
Sequence:CCGGGCTCTGTTGATTGTCACCATTCTCGAGAATGGTGACAATCAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-1515s1c1
Sequence:CCGGCCCGAATTATCCTACGAAATTCTCGAGAATTTCGTAGGATAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-638s1c1
Sequence:CCGGCGACACTGGATTTATCCTATACTCGAGTATAGGATAAATCCAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-2058s1c1
Sequence:CCGGCCGGTGTACCTGTGAATTAAACTCGAGTTTAATTCACAGGTACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-2850s1c1
Sequence:CCGGGCAGACATTCACAGAGTTAAACTCGAGTTTAACTCTGTGAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030956
TLR10 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-2886s21c1
Sequence:CCGGGGCCCAAGGATAGGCGTAAATCTCGAGATTTACGCCTATCCTTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-2313s21c1
Sequence:CCGGACGTTCATCTCCACGAATTATCTCGAGATAATTCGTGGAGATGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-1100s21c1
Sequence:CCGGATTGCTCATCTGCATCTAAATCTCGAGATTTAGATGCAGATGAGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030956.2-2509s21c1
Sequence:CCGGTGTCCGATTCCACGCATTTATCTCGAGATAAATGCGTGGAATCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-638s1c2
Sequence:CCGGCGACACTGGATTTATCCTATACTCGAGTATAGGATAAATCCAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-2215s1c1
Sequence:CCGGGCTCTGTTGATTGTCACCATTCTCGAGAATGGTGACAATCAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-1515s1c1
Sequence:CCGGCCCGAATTATCCTACGAAATTCTCGAGAATTTCGTAGGATAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-638s1c1
Sequence:CCGGCGACACTGGATTTATCCTATACTCGAGTATAGGATAAATCCAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-2058s1c1
Sequence:CCGGCCGGTGTACCTGTGAATTAAACTCGAGTTTAATTCACAGGTACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030956.1-2850s1c1
Sequence:CCGGGCAGACATTCACAGAGTTAAACTCGAGTTTAACTCTGTGAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks