EMAIL THIS PAGE TO A FRIEND

TLR1

toll-like receptor 1

Synonyms: CD281 TIL TIL. LPRS5 rsc786
UniProtKB ID: Q15399, D1CS39, D1CS41, O15452, Q32MK3, Q9UG90
Gene ID:
Human(7096) Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
Mouse(21897) toll-like receptor 1
Rat(305354) toll-like receptor 1
Zebrafish(403127) toll-like receptor 1
Horse(100049577) toll-like receptor 1
domestic cat(493660) toll-like receptor 1
dog(488834) toll-like receptor 1
cow(574090) toll-like receptor 1
sheep(554261) toll-like receptor 1
Goat(100861260) toll-like receptor 1
domestic guinea pig(100732850) toll-like receptor 1
naked mole-rat(101717639) toll-like receptor 1
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1748 Human TLR1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003263 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003263 Rosetta Predictions human pricing
NM_030682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081589 predicted 2588
2 SASI_Hs02_00335316 predicted 2486
3 SASI_Hs01_00081594 predicted 1387
4 SASI_Hs01_00081595 predicted 1074
5 SASI_Hs01_00081596 predicted 1372
6 SASI_Hs02_00335317 predicted 573
7 SASI_Hs01_00081597 predicted 445
8 SASI_Hs02_00335318 predicted 2250
9 SASI_Hs02_00335319 predicted 898
10 SASI_Hs02_00335320 predicted 654
11 SASI_Hs01_00081590 predicted 2345
12 SASI_Hs01_00081591 predicted 2438
13 SASI_Hs01_00081592 predicted 1654
14 SASI_Hs01_00081593 predicted 1751
15 SASI_Hs01_00081598 predicted 1692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117611 predicted 1537
2 SASI_Mm01_00117612 predicted 239
3 SASI_Mm01_00117613 predicted 2234
4 SASI_Mm01_00117614 predicted 1599
5 SASI_Mm01_00117616 predicted 1761
6 SASI_Mm01_00117617 predicted 1380
7 SASI_Mm01_00117618 predicted 2103
8 SASI_Mm01_00117619 predicted 836
9 SASI_Mm01_00117620 predicted 2168
10 SASI_Mm02_00336831 predicted 865
11 SASI_Mm01_00117615 predicted 1233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003263
VALIDATED
TLR1 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003263.3-658s1c1
Sequence:CCGGCCTGCCTATATGCAAAGAGTTCTCGAGAACTCTTTGCATATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003263.3-2212s1c1
Sequence:CCGGCGATTCTTTCTGGGTGAAGAACTCGAGTTCTTCACCCAGAAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003263.3-1081s1c1
Sequence:CCGGGCATACAACTGTATGGTATTTCTCGAGAAATACCATACAGTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003263.3-451s1c1
Sequence:CCGGGCTTTGGACTTCTGACATCTTCTCGAGAAGATGTCAGAAGTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003263.3-1217s1c1
Sequence:CCGGCCGCAAAGTTATATCTATGAACTCGAGTTCATAGATATAACTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-1462s21c1
Sequence:CCGGGATGAAGTCTCTGCAACAATTCTCGAGAATTGTTGCAGAGACTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-679s21c1
Sequence:CCGGTGGCAATATGTCTCAACTAAACTCGAGTTTAGTTGAGACATATTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-511s21c1
Sequence:CCGGTAGAATCCAGTATCTTGATATCTCGAGATATCAAGATACTGGATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-2586s21c1
Sequence:CCGGACTTAAGGGCAGCCATTAATACTCGAGTATTAATGGCTGCCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-649s21c1
Sequence:CCGGATTTGATGCCCTGCCTATATGCTCGAGCATATAGGCAGGGCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-914s21c1
Sequence:CCGGGCAAATCTGGAACTATCTAATCTCGAGATTAGATAGTTCCAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-2521s21c1
Sequence:CCGGCATGGCCAGGAGGACTTATTTCTCGAGAAATAAGTCCTCCTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003263
VALIDATED
TLR1 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003263.3-658s1c1
Sequence:CCGGCCTGCCTATATGCAAAGAGTTCTCGAGAACTCTTTGCATATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003263.3-2212s1c1
Sequence:CCGGCGATTCTTTCTGGGTGAAGAACTCGAGTTCTTCACCCAGAAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003263.3-1081s1c1
Sequence:CCGGGCATACAACTGTATGGTATTTCTCGAGAAATACCATACAGTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003263.3-451s1c1
Sequence:CCGGGCTTTGGACTTCTGACATCTTCTCGAGAAGATGTCAGAAGTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003263.3-1217s1c1
Sequence:CCGGCCGCAAAGTTATATCTATGAACTCGAGTTCATAGATATAACTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-1462s21c1
Sequence:CCGGGATGAAGTCTCTGCAACAATTCTCGAGAATTGTTGCAGAGACTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-679s21c1
Sequence:CCGGTGGCAATATGTCTCAACTAAACTCGAGTTTAGTTGAGACATATTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-511s21c1
Sequence:CCGGTAGAATCCAGTATCTTGATATCTCGAGATATCAAGATACTGGATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-2586s21c1
Sequence:CCGGACTTAAGGGCAGCCATTAATACTCGAGTATTAATGGCTGCCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-649s21c1
Sequence:CCGGATTTGATGCCCTGCCTATATGCTCGAGCATATAGGCAGGGCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-914s21c1
Sequence:CCGGGCAAATCTGGAACTATCTAATCTCGAGATTAGATAGTTCCAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-2521s21c1
Sequence:CCGGCATGGCCAGGAGGACTTATTTCTCGAGAAATAAGTCCTCCTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003263
VALIDATED
TLR1 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003263.3-658s1c1
Sequence:CCGGCCTGCCTATATGCAAAGAGTTCTCGAGAACTCTTTGCATATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003263.3-2212s1c1
Sequence:CCGGCGATTCTTTCTGGGTGAAGAACTCGAGTTCTTCACCCAGAAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003263.3-1081s1c1
Sequence:CCGGGCATACAACTGTATGGTATTTCTCGAGAAATACCATACAGTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003263.3-451s1c1
Sequence:CCGGGCTTTGGACTTCTGACATCTTCTCGAGAAGATGTCAGAAGTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003263.3-1217s1c1
Sequence:CCGGCCGCAAAGTTATATCTATGAACTCGAGTTCATAGATATAACTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-1462s21c1
Sequence:CCGGGATGAAGTCTCTGCAACAATTCTCGAGAATTGTTGCAGAGACTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-679s21c1
Sequence:CCGGTGGCAATATGTCTCAACTAAACTCGAGTTTAGTTGAGACATATTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-511s21c1
Sequence:CCGGTAGAATCCAGTATCTTGATATCTCGAGATATCAAGATACTGGATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-2586s21c1
Sequence:CCGGACTTAAGGGCAGCCATTAATACTCGAGTATTAATGGCTGCCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-649s21c1
Sequence:CCGGATTTGATGCCCTGCCTATATGCTCGAGCATATAGGCAGGGCATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-914s21c1
Sequence:CCGGGCAAATCTGGAACTATCTAATCTCGAGATTAGATAGTTCCAGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003263.3-2521s21c1
Sequence:CCGGCATGGCCAGGAGGACTTATTTCTCGAGAAATAAGTCCTCCTGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030682
TLR1 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-561s1c1
Sequence:CCGGCCTGCCTATATGCAAAGAATTCTCGAGAATTCTTTGCATATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-2394s1c1
Sequence:CCGGCCCTACCAATTACCACAAGCTCTCGAGAGCTTGTGGTAATTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-255s1c1
Sequence:CCGGGCTTATCATAAAGAGGCCAAACTCGAGTTTGGCCTCTTTATGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-1039s1c1
Sequence:CCGGGCCTTCAGGATGTTCAATTATCTCGAGATAATTGAACATCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-1207s21c1
Sequence:CCGGCCGTCCCAAGTTAGCCCATTTCTCGAGAAATGGGCTAACTTGGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-2385s21c1
Sequence:CCGGGTACTCCATCCCTACCAATTACTCGAGTAATTGGTAGGGATGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-307s21c1
Sequence:CCGGCCCTTGCAAACAACTACTTTACTCGAGTAAAGTAGTTGTTTGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-411s21c1
Sequence:CCGGCAACAGACTCCAGTATCTTAACTCGAGTTAAGATACTGGAGTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030682
TLR1 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-561s1c1
Sequence:CCGGCCTGCCTATATGCAAAGAATTCTCGAGAATTCTTTGCATATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-2394s1c1
Sequence:CCGGCCCTACCAATTACCACAAGCTCTCGAGAGCTTGTGGTAATTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-255s1c1
Sequence:CCGGGCTTATCATAAAGAGGCCAAACTCGAGTTTGGCCTCTTTATGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-1039s1c1
Sequence:CCGGGCCTTCAGGATGTTCAATTATCTCGAGATAATTGAACATCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-1207s21c1
Sequence:CCGGCCGTCCCAAGTTAGCCCATTTCTCGAGAAATGGGCTAACTTGGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-2385s21c1
Sequence:CCGGGTACTCCATCCCTACCAATTACTCGAGTAATTGGTAGGGATGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-307s21c1
Sequence:CCGGCCCTTGCAAACAACTACTTTACTCGAGTAAAGTAGTTGTTTGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-411s21c1
Sequence:CCGGCAACAGACTCCAGTATCTTAACTCGAGTTAAGATACTGGAGTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030682
TLR1 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-561s1c1
Sequence:CCGGCCTGCCTATATGCAAAGAATTCTCGAGAATTCTTTGCATATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-2394s1c1
Sequence:CCGGCCCTACCAATTACCACAAGCTCTCGAGAGCTTGTGGTAATTGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-255s1c1
Sequence:CCGGGCTTATCATAAAGAGGCCAAACTCGAGTTTGGCCTCTTTATGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030682.1-1039s1c1
Sequence:CCGGGCCTTCAGGATGTTCAATTATCTCGAGATAATTGAACATCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-1207s21c1
Sequence:CCGGCCGTCCCAAGTTAGCCCATTTCTCGAGAAATGGGCTAACTTGGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-2385s21c1
Sequence:CCGGGTACTCCATCCCTACCAATTACTCGAGTAATTGGTAGGGATGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-307s21c1
Sequence:CCGGCCCTTGCAAACAACTACTTTACTCGAGTAAAGTAGTTGTTTGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030682.1-411s21c1
Sequence:CCGGCAACAGACTCCAGTATCTTAACTCGAGTTAAGATACTGGAGTCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks