EMAIL THIS PAGE TO A FRIEND

TLR2

toll-like receptor 2

Synonyms: CD282 TIL4
Gene ID:
Human(7097) Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is expressed most abundantly in peripheral blood leukocytes, and mediates host response to Gram-positive bacteria and yeast via stimulation of NF-kappaB. [provided by RefSeq, Jul 2008]
Mouse(24088) toll-like receptor 2
Rat(310553) toll-like receptor 2
Zebrafish(403125) toll-like receptor 2
Horse(100009701) toll-like receptor 2
domestic cat(493797) toll-like receptor 2
dog(448807) toll-like receptor 2
domestic guinea pig(100717682) toll-like receptor 2
naked mole-rat(101724657) toll-like receptor 2
Domestic Rabbit(100009578) toll-like receptor 2
cow(281534) toll-like receptor 2
sheep(554262) toll-like receptor 2
Goat(100860747) toll-like receptor 2
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300199 Anti-Mouse Tlr2 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1300198 Anti-Mouse Tlr2 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB2108727 Anti-TLR2 affinity isolated antibody mouse, bovine, mouse, pig, sheep, canine, rat, horse, zebrafish, goat, guinea pig
immunohistochemistry, western blot pricing
GW22787 Anti-TLR2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
PRS3135 Anti-TLR2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2102440 Anti-TLR2 antibody produced in rabbit affinity isolated antibody rat, human, guinea pig, mouse, horse
western blot pricing
WH0007097M7 Monoclonal Anti-TLR2 antibody produced in mouse clone 1E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404474 Monoclonal Anti-TLR2 antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409745 Monoclonal Anti-TLR2 antibody produced in mouse clone 2A3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409746 Monoclonal Anti-TLR2 antibody produced in mouse clone 2D2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409747 Monoclonal Anti-TLR2 antibody produced in mouse clone 3F10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409748 Monoclonal Anti-TLR2 antibody produced in mouse clone 1E3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409749 Monoclonal Anti-TLR2 antibody produced in mouse clone 4D6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409750 Monoclonal Anti-TLR2 antibody produced in mouse clone 4G9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409751 Monoclonal Anti-TLR2 antibody produced in mouse clone 1C6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409752 Monoclonal Anti-TLR2 antibody produced in mouse clone 1B10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409753 Monoclonal Anti-TLR2 antibody produced in mouse clone 4C4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409754 Monoclonal Anti-TLR2 antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409755 Monoclonal Anti-TLR2 antibody produced in mouse clone 4H6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

ELISA

Product # Description Species Add to Cart
 
RAB0744 Human TLR2 / Toll-like Receptor 2 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003264 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010011 MISSION® esiRNA esiRNA targeting mouse Tlr2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003264 Rosetta Predictions human pricing
NM_198769 Rosetta Predictions rat pricing
NM_011905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074934 predicted 485
2 SASI_Hs01_00074935 predicted 872
3 SASI_Hs01_00074936 predicted 1123
4 SASI_Hs01_00074937 predicted 1608
5 SASI_Hs01_00074938 predicted 1882
6 SASI_Hs01_00074939 predicted 936
7 SASI_Hs01_00074940 predicted 754
8 SASI_Hs01_00074941 predicted 1075
9 SASI_Hs01_00074942 predicted 1133
10 SASI_Hs01_00074943 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270015 predicted 2065
2 SASI_Rn01_00115581 predicted 601
3 SASI_Rn01_00115582 predicted 962
4 SASI_Rn01_00115583 predicted 730
5 SASI_Rn01_00115584 predicted 494
6 SASI_Rn02_00270016 predicted 393
7 SASI_Rn02_00270017 predicted 1059
8 SASI_Rn01_00115585 predicted 621
9 SASI_Rn02_00270018 predicted 636
10 SASI_Rn01_00115586 predicted 279
11 SASI_Rn01_00115587 predicted 712
12 SASI_Rn01_00115588 predicted 796
13 SASI_Rn01_00115589 predicted 1021
14 SASI_Rn01_00115590 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135214 predicted 891
2 SASI_Mm01_00135215 predicted 682
3 SASI_Mm01_00135216 predicted 810
4 SASI_Mm01_00135217 predicted 1251
5 SASI_Mm01_00135218 predicted 820
6 SASI_Mm01_00135219 predicted 2561
7 SASI_Mm01_00135220 predicted 545
8 SASI_Mm01_00135221 predicted 1040
9 SASI_Mm01_00135222 predicted 1870
10 SASI_Mm01_00135223 predicted 1018
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011905
VALIDATED
TLR2 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011905.2-2896s1c1
Sequence:CCGGCTAAGGTCTTTGTGACACAAACTCGAGTTTGTGTCACAAAGACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011905.2-810s1c1
Sequence:CCGGGCAGTCTTGAACATTTGGATTCTCGAGAATCCAAATGTTCAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011905.2-2726s1c1
Sequence:CCGGCCCATTGAGAGGAAAGCCATTCTCGAGAATGGCTTTCCTCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011905.2-2127s1c1
Sequence:CCGGGCGAACTCCTATCCTTTACTACTCGAGTAGTAAAGGATAGGAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011905.2-1695s1c1
Sequence:CCGGGCCAGAATCATTTGAGATCAACTCGAGTTGATCTCAAATGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011905.3-1031s21c1
Sequence:CCGGTTAGAACTAAGAGATACTAACCTCGAGGTTAGTATCTCTTAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-1538s21c1
Sequence:CCGGCAGAATCATTTGAGATCAATGCTCGAGCATTGATCTCAAATGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011905.3-1687s21c1
Sequence:CCGGTACAGGGATCCGGGTGGTAAACTCGAGTTTACCACCCGGATCCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-2598s21c1
Sequence:CCGGTCTGCAAACTGCGCAAGATAACTCGAGTTATCTTGCGCAGTTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-2391s21c1
Sequence:CCGGTTCCGGGCAAATGGATCATTGCTCGAGCAATGATCCATTTGCCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-677s21c1
Sequence:CCGGGATAATCACCTATCTAGTTTACTCGAGTAAACTAGATAGGTGATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-1288s21c1
Sequence:CCGGCACTATCCGGAGGTTGCATATCTCGAGATATGCAACCTCCGGATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011905
VALIDATED
TLR2 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011905.2-2896s1c1
Sequence:CCGGCTAAGGTCTTTGTGACACAAACTCGAGTTTGTGTCACAAAGACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011905.2-810s1c1
Sequence:CCGGGCAGTCTTGAACATTTGGATTCTCGAGAATCCAAATGTTCAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011905.2-2726s1c1
Sequence:CCGGCCCATTGAGAGGAAAGCCATTCTCGAGAATGGCTTTCCTCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011905.2-2127s1c1
Sequence:CCGGGCGAACTCCTATCCTTTACTACTCGAGTAGTAAAGGATAGGAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011905.2-1695s1c1
Sequence:CCGGGCCAGAATCATTTGAGATCAACTCGAGTTGATCTCAAATGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011905.3-1031s21c1
Sequence:CCGGTTAGAACTAAGAGATACTAACCTCGAGGTTAGTATCTCTTAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-1538s21c1
Sequence:CCGGCAGAATCATTTGAGATCAATGCTCGAGCATTGATCTCAAATGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011905.3-1687s21c1
Sequence:CCGGTACAGGGATCCGGGTGGTAAACTCGAGTTTACCACCCGGATCCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-2598s21c1
Sequence:CCGGTCTGCAAACTGCGCAAGATAACTCGAGTTATCTTGCGCAGTTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-2391s21c1
Sequence:CCGGTTCCGGGCAAATGGATCATTGCTCGAGCAATGATCCATTTGCCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-677s21c1
Sequence:CCGGGATAATCACCTATCTAGTTTACTCGAGTAAACTAGATAGGTGATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-1288s21c1
Sequence:CCGGCACTATCCGGAGGTTGCATATCTCGAGATATGCAACCTCCGGATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011905
VALIDATED
TLR2 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011905.2-2896s1c1
Sequence:CCGGCTAAGGTCTTTGTGACACAAACTCGAGTTTGTGTCACAAAGACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011905.2-810s1c1
Sequence:CCGGGCAGTCTTGAACATTTGGATTCTCGAGAATCCAAATGTTCAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011905.2-2726s1c1
Sequence:CCGGCCCATTGAGAGGAAAGCCATTCTCGAGAATGGCTTTCCTCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011905.2-2127s1c1
Sequence:CCGGGCGAACTCCTATCCTTTACTACTCGAGTAGTAAAGGATAGGAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011905.2-1695s1c1
Sequence:CCGGGCCAGAATCATTTGAGATCAACTCGAGTTGATCTCAAATGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011905.3-1031s21c1
Sequence:CCGGTTAGAACTAAGAGATACTAACCTCGAGGTTAGTATCTCTTAGTTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-1538s21c1
Sequence:CCGGCAGAATCATTTGAGATCAATGCTCGAGCATTGATCTCAAATGATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011905.3-1687s21c1
Sequence:CCGGTACAGGGATCCGGGTGGTAAACTCGAGTTTACCACCCGGATCCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-2598s21c1
Sequence:CCGGTCTGCAAACTGCGCAAGATAACTCGAGTTATCTTGCGCAGTTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-2391s21c1
Sequence:CCGGTTCCGGGCAAATGGATCATTGCTCGAGCAATGATCCATTTGCCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-677s21c1
Sequence:CCGGGATAATCACCTATCTAGTTTACTCGAGTAAACTAGATAGGTGATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011905.3-1288s21c1
Sequence:CCGGCACTATCCGGAGGTTGCATATCTCGAGATATGCAACCTCCGGATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003264
TLR2 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1484s1c1
Sequence:CCGGGCACACGAATACACAGTGTAACTCGAGTTACACTGTGTATTCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1039s1c1
Sequence:CCGGGCATCTGATAATGACAGAGTTCTCGAGAACTCTGTCATTATCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1204s1c1
Sequence:CCGGCCTTGTTTACTTTCACAACATCTCGAGATGTTGTGAAAGTAAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-2406s1c1
Sequence:CCGGGCGGAAGATAATGAACACCAACTCGAGTTGGTGTTCATTATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1645s1c1
Sequence:CCGGCCCATGTTACTAGTATTGAAACTCGAGTTTCAATACTAGTAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003264.3-2892s21c1
Sequence:CCGGGATGATCAAGTCCCTTATAAGCTCGAGCTTATAAGGGACTTGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003264.3-1544s21c1
Sequence:CCGGACTTATCCAGCACACGAATACCTCGAGGTATTCGTGTGCTGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003264.3-1069s21c1
Sequence:CCGGTTTGATGACTGTACCCTTAATCTCGAGATTAAGGGTACAGTCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003264.3-2665s21c1
Sequence:CCGGTACGTGGATGTACCGTCATTTCTCGAGAAATGACGGTACATCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003264
TLR2 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1484s1c1
Sequence:CCGGGCACACGAATACACAGTGTAACTCGAGTTACACTGTGTATTCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1039s1c1
Sequence:CCGGGCATCTGATAATGACAGAGTTCTCGAGAACTCTGTCATTATCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1204s1c1
Sequence:CCGGCCTTGTTTACTTTCACAACATCTCGAGATGTTGTGAAAGTAAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-2406s1c1
Sequence:CCGGGCGGAAGATAATGAACACCAACTCGAGTTGGTGTTCATTATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1645s1c1
Sequence:CCGGCCCATGTTACTAGTATTGAAACTCGAGTTTCAATACTAGTAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003264.3-2892s21c1
Sequence:CCGGGATGATCAAGTCCCTTATAAGCTCGAGCTTATAAGGGACTTGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003264.3-1544s21c1
Sequence:CCGGACTTATCCAGCACACGAATACCTCGAGGTATTCGTGTGCTGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003264.3-1069s21c1
Sequence:CCGGTTTGATGACTGTACCCTTAATCTCGAGATTAAGGGTACAGTCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003264.3-2665s21c1
Sequence:CCGGTACGTGGATGTACCGTCATTTCTCGAGAAATGACGGTACATCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003264
TLR2 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1484s1c1
Sequence:CCGGGCACACGAATACACAGTGTAACTCGAGTTACACTGTGTATTCGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1039s1c1
Sequence:CCGGGCATCTGATAATGACAGAGTTCTCGAGAACTCTGTCATTATCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1204s1c1
Sequence:CCGGCCTTGTTTACTTTCACAACATCTCGAGATGTTGTGAAAGTAAACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-2406s1c1
Sequence:CCGGGCGGAAGATAATGAACACCAACTCGAGTTGGTGTTCATTATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003264.2-1645s1c1
Sequence:CCGGCCCATGTTACTAGTATTGAAACTCGAGTTTCAATACTAGTAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003264.3-2892s21c1
Sequence:CCGGGATGATCAAGTCCCTTATAAGCTCGAGCTTATAAGGGACTTGATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003264.3-1544s21c1
Sequence:CCGGACTTATCCAGCACACGAATACCTCGAGGTATTCGTGTGCTGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003264.3-1069s21c1
Sequence:CCGGTTTGATGACTGTACCCTTAATCTCGAGATTAAGGGTACAGTCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003264.3-2665s21c1
Sequence:CCGGTACGTGGATGTACCGTCATTTCTCGAGAAATGACGGTACATCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks