EMAIL THIS PAGE TO A FRIEND

TLR3

toll-like receptor 3

Synonyms: CD283 IIAE2
UniProtKB ID: O15455, Q4VAL2
Gene ID:
Human(7098) Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008]
Mouse(142980) toll-like receptor 3
Rat(364594) toll-like receptor 3
Zebrafish(403126) toll-like receptor 3
Horse(100009703) toll-like receptor 3
domestic cat(493661) toll-like receptor 3
dog(482905) toll-like receptor 3
chicken(422720) toll-like receptor 3
cow(281535) toll-like receptor 3
sheep(554258) toll-like receptor 3
Domestic Rabbit(100009024) toll-like receptor 3
naked mole-rat(101716400) toll-like receptor 3
domestic guinea pig(100135634) toll-like receptor 3
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1749 Human TLR3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_126166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_126166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_126166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003265 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003265 Rosetta Predictions human pricing
NM_198791 Rosetta Predictions rat pricing
XM_001061463 Rosetta Predictions rat pricing
NM_126166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231802 predicted 896
2 SASI_Hs01_00231803 predicted 2751
3 SASI_Hs01_00231804 predicted 670
4 SASI_Hs02_00335321 predicted 814
5 SASI_Hs01_00231805 predicted 1234
6 SASI_Hs01_00231806 predicted 1408
7 SASI_Hs01_00231807 predicted 2108
8 SASI_Hs01_00231808 predicted 2005
9 SASI_Hs01_00231809 predicted 1864
10 SASI_Hs01_00231810 predicted 843
11 SASI_Hs01_00231811 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098255 predicted 653
2 SASI_Rn02_00270070 predicted 3064
3 SASI_Rn01_00098256 predicted 1476
4 SASI_Rn01_00098257 predicted 817
5 SASI_Rn01_00098259 predicted 750
6 SASI_Rn01_00098260 predicted 581
7 SASI_Rn01_00098261 predicted 1685
8 SASI_Rn01_00098262 predicted 1442
9 SASI_Rn01_00098263 predicted 2479
10 SASI_Rn01_00098264 predicted 673
11 SASI_Rn01_00098258 predicted 2908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300184 predicted 465
2 SASI_Rn02_00300185 predicted 2805
3 SASI_Rn02_00300186 predicted 1296
4 SASI_Rn02_00300187 predicted 560
5 SASI_Rn02_00300188 predicted 391
6 SASI_Rn02_00300189 predicted 1254
7 SASI_Rn02_00300190 predicted 2220
8 SASI_Rn02_00300191 predicted 2740
9 SASI_Rn02_00300192 predicted 2639
10 SASI_Rn02_00300193 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_126166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187622 predicted 2802
2 SASI_Mm01_00187623 predicted 667
3 SASI_Mm01_00187624 predicted 1009
4 SASI_Mm01_00187626 predicted 943
5 SASI_Mm02_00338242 predicted 2917
6 SASI_Mm01_00187627 predicted 1665
7 SASI_Mm02_00338243 predicted 923
8 SASI_Mm01_00187628 predicted 2759
9 SASI_Mm01_00187630 predicted 2393
10 SASI_Mm01_00187631 predicted 2724
11 SASI_Mm01_00187625 predicted 2638
12 SASI_Mm01_00187629 predicted 1530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_126166
TLR3 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126166.4-504s21c1
Sequence:CCGGATGATCTTCCCTCTAACATAACTCGAGTTATGTTAGAGGGAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126166.4-1667s21c1
Sequence:CCGGATACTTGATCTCGGCCTTAATCTCGAGATTAAGGCCGAGATCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126166.4-558s21c1
Sequence:CCGGGATTACCACCTACCAACTTTACTCGAGTAAAGTTGGTAGGTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-2225s1c1
Sequence:CCGGCCTCATAACATCTGTTGAGAACTCGAGTTCTCAACAGATGTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-2466s1c1
Sequence:CCGGCCCTTTGAACTCCTCTTCATACTCGAGTATGAAGAGGAGTTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-1359s1c1
Sequence:CCGGGCATTTACTAAGCAAAGTGTTCTCGAGAACACTTTGCTTAGTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-2638s1c1
Sequence:CCGGCCTACATAATTCATGCCCATACTCGAGTATGGGCATGAATTATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_126166.2-4155s1c1
Sequence:CCGGCCACAGTGATAGATGGCATTTCTCGAGAAATGCCATCTATCACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_126166
TLR3 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126166.4-504s21c1
Sequence:CCGGATGATCTTCCCTCTAACATAACTCGAGTTATGTTAGAGGGAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126166.4-1667s21c1
Sequence:CCGGATACTTGATCTCGGCCTTAATCTCGAGATTAAGGCCGAGATCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126166.4-558s21c1
Sequence:CCGGGATTACCACCTACCAACTTTACTCGAGTAAAGTTGGTAGGTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-2225s1c1
Sequence:CCGGCCTCATAACATCTGTTGAGAACTCGAGTTCTCAACAGATGTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-2466s1c1
Sequence:CCGGCCCTTTGAACTCCTCTTCATACTCGAGTATGAAGAGGAGTTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-1359s1c1
Sequence:CCGGGCATTTACTAAGCAAAGTGTTCTCGAGAACACTTTGCTTAGTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-2638s1c1
Sequence:CCGGCCTACATAATTCATGCCCATACTCGAGTATGGGCATGAATTATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_126166.2-4155s1c1
Sequence:CCGGCCACAGTGATAGATGGCATTTCTCGAGAAATGCCATCTATCACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_126166
TLR3 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126166.4-504s21c1
Sequence:CCGGATGATCTTCCCTCTAACATAACTCGAGTTATGTTAGAGGGAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126166.4-1667s21c1
Sequence:CCGGATACTTGATCTCGGCCTTAATCTCGAGATTAAGGCCGAGATCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_126166.4-558s21c1
Sequence:CCGGGATTACCACCTACCAACTTTACTCGAGTAAAGTTGGTAGGTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-2225s1c1
Sequence:CCGGCCTCATAACATCTGTTGAGAACTCGAGTTCTCAACAGATGTTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-2466s1c1
Sequence:CCGGCCCTTTGAACTCCTCTTCATACTCGAGTATGAAGAGGAGTTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-1359s1c1
Sequence:CCGGGCATTTACTAAGCAAAGTGTTCTCGAGAACACTTTGCTTAGTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_126166.2-2638s1c1
Sequence:CCGGCCTACATAATTCATGCCCATACTCGAGTATGGGCATGAATTATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_126166.2-4155s1c1
Sequence:CCGGCCACAGTGATAGATGGCATTTCTCGAGAAATGCCATCTATCACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003265
VALIDATED
TLR3 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003265.2-455s21c1
Sequence:CCGGCTTTGCCTTCTGCACGAATTTCTCGAGAAATTCGTGCAGAAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003265.2-2866s21c1
Sequence:CCGGAGTTCTATGGCAAATTTAAGTCTCGAGACTTAAATTTGCCATAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003265.2-2547s21c1
Sequence:CCGGGTTATAACACACCATCTATTACTCGAGTAATAGATGGTGTGTTATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003265.2-2842s21c1
Sequence:CCGGAGGAGAAACTTTCTCAATTTACTCGAGTAAATTGAGAAAGTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003265.2-752s21c1
Sequence:CCGGTCACGCAATTGGAAGATTATTCTCGAGAATAATCTTCCAATTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003265.2-2739s1c1
Sequence:CCGGCCAGTTCAGAAAGAACGGATACTCGAGTATCCGTTCTTTCTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003265.2-1611s1c1
Sequence:CCGGCCTCTTCGTAACTTGACCATTCTCGAGAATGGTCAAGTTACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003265
VALIDATED
TLR3 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003265.2-455s21c1
Sequence:CCGGCTTTGCCTTCTGCACGAATTTCTCGAGAAATTCGTGCAGAAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003265.2-2866s21c1
Sequence:CCGGAGTTCTATGGCAAATTTAAGTCTCGAGACTTAAATTTGCCATAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003265.2-2547s21c1
Sequence:CCGGGTTATAACACACCATCTATTACTCGAGTAATAGATGGTGTGTTATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003265.2-2842s21c1
Sequence:CCGGAGGAGAAACTTTCTCAATTTACTCGAGTAAATTGAGAAAGTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003265.2-752s21c1
Sequence:CCGGTCACGCAATTGGAAGATTATTCTCGAGAATAATCTTCCAATTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003265.2-2739s1c1
Sequence:CCGGCCAGTTCAGAAAGAACGGATACTCGAGTATCCGTTCTTTCTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003265.2-1611s1c1
Sequence:CCGGCCTCTTCGTAACTTGACCATTCTCGAGAATGGTCAAGTTACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003265
VALIDATED
TLR3 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003265.2-455s21c1
Sequence:CCGGCTTTGCCTTCTGCACGAATTTCTCGAGAAATTCGTGCAGAAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003265.2-2866s21c1
Sequence:CCGGAGTTCTATGGCAAATTTAAGTCTCGAGACTTAAATTTGCCATAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003265.2-2547s21c1
Sequence:CCGGGTTATAACACACCATCTATTACTCGAGTAATAGATGGTGTGTTATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003265.2-2842s21c1
Sequence:CCGGAGGAGAAACTTTCTCAATTTACTCGAGTAAATTGAGAAAGTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003265.2-752s21c1
Sequence:CCGGTCACGCAATTGGAAGATTATTCTCGAGAATAATCTTCCAATTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003265.2-2739s1c1
Sequence:CCGGCCAGTTCAGAAAGAACGGATACTCGAGTATCCGTTCTTTCTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003265.2-1611s1c1
Sequence:CCGGCCTCTTCGTAACTTGACCATTCTCGAGAATGGTCAAGTTACGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks