EMAIL THIS PAGE TO A FRIEND

TLR4

toll-like receptor 4

Synonyms: ARMD10 CD284 TLR-4 TOLL
Gene ID:
Human(7099) Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(21898) toll-like receptor 4
Rat(29260) toll-like receptor 4
domestic guinea pig(100724803) toll-like receptor 4
naked mole-rat(101715916) toll-like receptor 4
Domestic Rabbit(100009497) toll-like receptor 4
cow(281536) toll-like receptor 4
Goat(100860955) toll-like receptor 4
sheep(554263) toll-like receptor 4
chicken(417241) toll-like receptor 4
Horse(100066890) toll-like receptor 4
domestic cat(493698) toll-like receptor 4
dog(403417) toll-like receptor 4
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302747 ANTI-MOUSE TLR4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
ELISA, immunohistochemistry pricing
SAB1301541 ANTI-MOUSE TLR4 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB1412080 ANTI-TLR4 antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412548 ANTI-TLR4 antibody produced in mouse clone 4B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412602 ANTI-TLR4 antibody produced in mouse clone 3G12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS3141 Anti-TLR4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
HPA049174 Anti-TLR4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB3500765 Anti-TLR4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry pricing
SAB1404475 Monoclonal Anti-TLR4 antibody produced in mouse clone 3B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1402375 Monoclonal Anti-TLR4 antibody produced in mouse clone 1H7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003266 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138554 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138554 siRNAs that have been validated in the lab human pricing
NM_019178 Rosetta Predictions rat pricing
NM_021297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138554 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122250 validated 1025
2 SASI_Hs01_00122248 predicted 235
3 SASI_Hs01_00122249 predicted 691
4 SASI_Hs01_00122251 predicted 1128
5 SASI_Hs01_00122252 predicted 348
6 SASI_Hs01_00122253 predicted 424
7 SASI_Hs01_00122254 predicted 1873
8 SASI_Hs01_00122255 predicted 2257
9 SASI_Hs02_00363696 predicted 1477
10 SASI_Hs02_00363697 predicted 1364
11 SASI_Hs01_00122256 predicted 1020
12 SASI_Hs01_00122257 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052898 predicted 2766
2 SASI_Rn01_00052899 predicted 2092
3 SASI_Rn02_00261968 predicted 2239
4 SASI_Rn01_00052901 predicted 1417
5 SASI_Rn01_00052902 predicted 1076
6 SASI_Rn02_00261969 predicted 481
7 SASI_Rn01_00052903 predicted 898
8 SASI_Rn01_00052905 predicted 1135
9 SASI_Rn01_00052906 predicted 2422
10 SASI_Rn01_00052907 predicted 1787
11 SASI_Rn01_00052900 predicted 1932
12 SASI_Rn01_00052904 predicted 2733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139037 predicted 864
2 SASI_Mm01_00139038 predicted 2028
3 SASI_Mm01_00139039 predicted 2203
4 SASI_Mm01_00139040 predicted 379
5 SASI_Mm01_00139042 predicted 936
6 SASI_Mm01_00139043 predicted 2056
7 SASI_Mm01_00139044 predicted 1711
8 SASI_Mm01_00139045 predicted 1562
9 SASI_Mm01_00139046 predicted 2543
10 SASI_Mm02_00325835 predicted 594
11 SASI_Mm01_00139041 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021297
VALIDATED
TLR4 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021297.1-3054s1c1
Sequence:CCGGGCCAATCCTAAGAATGCTATACTCGAGTATAGCATTCTTAGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021297.1-509s1c1
Sequence:CCGGCCTGTAAGTTACCTGCATATTCTCGAGAATATGCAGGTAACTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021297.1-1246s1c1
Sequence:CCGGGCCATCATTATGAGTGCCAATCTCGAGATTGGCACTCATAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021297.1-1568s1c1
Sequence:CCGGCCCTCCATAGACTTCAATTATCTCGAGATAATTGAAGTCTATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021297.2-2555s21c1
Sequence:CCGGCCCAGTCTGTTTGCAATTAATCTCGAGATTAATTGCAAACAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021297.2-2247s21c1
Sequence:CCGGCCGTTGGTGTATCTTTGAATACTCGAGTATTCAAAGATACACCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021297.2-1246s21c1
Sequence:CCGGGCCATCATTATGAGTGCCAATCTCGAGATTGGCACTCATAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021297.2-509s21c1
Sequence:CCGGCCTGTAAGTTACCTGCATATTCTCGAGAATATGCAGGTAACTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021297.2-107s21c1
Sequence:CCGGTAGAGGTAGTTCCTAATATTACTCGAGTAATATTAGGAACTACCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021297
VALIDATED
TLR4 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021297.1-3054s1c1
Sequence:CCGGGCCAATCCTAAGAATGCTATACTCGAGTATAGCATTCTTAGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021297.1-509s1c1
Sequence:CCGGCCTGTAAGTTACCTGCATATTCTCGAGAATATGCAGGTAACTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021297.1-1246s1c1
Sequence:CCGGGCCATCATTATGAGTGCCAATCTCGAGATTGGCACTCATAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021297.1-1568s1c1
Sequence:CCGGCCCTCCATAGACTTCAATTATCTCGAGATAATTGAAGTCTATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021297.2-2555s21c1
Sequence:CCGGCCCAGTCTGTTTGCAATTAATCTCGAGATTAATTGCAAACAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021297.2-2247s21c1
Sequence:CCGGCCGTTGGTGTATCTTTGAATACTCGAGTATTCAAAGATACACCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021297.2-1246s21c1
Sequence:CCGGGCCATCATTATGAGTGCCAATCTCGAGATTGGCACTCATAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021297.2-509s21c1
Sequence:CCGGCCTGTAAGTTACCTGCATATTCTCGAGAATATGCAGGTAACTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021297.2-107s21c1
Sequence:CCGGTAGAGGTAGTTCCTAATATTACTCGAGTAATATTAGGAACTACCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021297
VALIDATED
TLR4 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021297.1-3054s1c1
Sequence:CCGGGCCAATCCTAAGAATGCTATACTCGAGTATAGCATTCTTAGGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021297.1-509s1c1
Sequence:CCGGCCTGTAAGTTACCTGCATATTCTCGAGAATATGCAGGTAACTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021297.1-1246s1c1
Sequence:CCGGGCCATCATTATGAGTGCCAATCTCGAGATTGGCACTCATAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021297.1-1568s1c1
Sequence:CCGGCCCTCCATAGACTTCAATTATCTCGAGATAATTGAAGTCTATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021297.2-2555s21c1
Sequence:CCGGCCCAGTCTGTTTGCAATTAATCTCGAGATTAATTGCAAACAGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021297.2-2247s21c1
Sequence:CCGGCCGTTGGTGTATCTTTGAATACTCGAGTATTCAAAGATACACCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021297.2-1246s21c1
Sequence:CCGGGCCATCATTATGAGTGCCAATCTCGAGATTGGCACTCATAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021297.2-509s21c1
Sequence:CCGGCCTGTAAGTTACCTGCATATTCTCGAGAATATGCAGGTAACTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021297.2-107s21c1
Sequence:CCGGTAGAGGTAGTTCCTAATATTACTCGAGTAATATTAGGAACTACCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003266
TLR4 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-2519s1c1
Sequence:CCGGCCGCTGGTGTATCTTTGAATACTCGAGTATTCAAAGATACACCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-1989s1c1
Sequence:CCGGCCAAGTAGTCTAGCTTTCTTACTCGAGTAAGAAAGCTAGACTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-2728s1c1
Sequence:CCGGCCCTGCTGGATGGTAAATCATCTCGAGATGATTTACCATCCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-1056s1c1
Sequence:CCGGCGTTTGGTTCTGGGAGAATTTCTCGAGAAATTCTCCCAGAACCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-592s1c1
Sequence:CCGGGCCACCTCTCTACCTTAATATCTCGAGATATTAAGGTAGAGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003266
TLR4 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-2519s1c1
Sequence:CCGGCCGCTGGTGTATCTTTGAATACTCGAGTATTCAAAGATACACCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-1989s1c1
Sequence:CCGGCCAAGTAGTCTAGCTTTCTTACTCGAGTAAGAAAGCTAGACTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-2728s1c1
Sequence:CCGGCCCTGCTGGATGGTAAATCATCTCGAGATGATTTACCATCCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-1056s1c1
Sequence:CCGGCGTTTGGTTCTGGGAGAATTTCTCGAGAAATTCTCCCAGAACCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-592s1c1
Sequence:CCGGGCCACCTCTCTACCTTAATATCTCGAGATATTAAGGTAGAGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003266
TLR4 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-2519s1c1
Sequence:CCGGCCGCTGGTGTATCTTTGAATACTCGAGTATTCAAAGATACACCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-1989s1c1
Sequence:CCGGCCAAGTAGTCTAGCTTTCTTACTCGAGTAAGAAAGCTAGACTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-2728s1c1
Sequence:CCGGCCCTGCTGGATGGTAAATCATCTCGAGATGATTTACCATCCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-1056s1c1
Sequence:CCGGCGTTTGGTTCTGGGAGAATTTCTCGAGAAATTCTCCCAGAACCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003266.2-592s1c1
Sequence:CCGGGCCACCTCTCTACCTTAATATCTCGAGATATTAAGGTAGAGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138554
TLR4 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 4
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000358568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138554.3-385s21c1
Sequence:CCGGGTGGTTCCTAATATTACTTATCTCGAGATAAGTAATATTAGGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138554.3-756s21c1
Sequence:CCGGTAATGTGGCTCACAATCTTATCTCGAGATAAGATTGTGAGCCACATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138554.3-1170s21c1
Sequence:CCGGAGACTACTACCTCGATGATATCTCGAGATATCATCGAGGTAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138554
TLR4 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 4
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000358568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138554.3-385s21c1
Sequence:CCGGGTGGTTCCTAATATTACTTATCTCGAGATAAGTAATATTAGGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138554.3-756s21c1
Sequence:CCGGTAATGTGGCTCACAATCTTATCTCGAGATAAGATTGTGAGCCACATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138554.3-1170s21c1
Sequence:CCGGAGACTACTACCTCGATGATATCTCGAGATATCATCGAGGTAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138554
TLR4 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 4
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000358568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138554.3-385s21c1
Sequence:CCGGGTGGTTCCTAATATTACTTATCTCGAGATAAGTAATATTAGGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138554.3-756s21c1
Sequence:CCGGTAATGTGGCTCACAATCTTATCTCGAGATAAGATTGTGAGCCACATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138554.3-1170s21c1
Sequence:CCGGAGACTACTACCTCGATGATATCTCGAGATATCATCGAGGTAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks