EMAIL THIS PAGE TO A FRIEND

TLR5

toll-like receptor 5

Synonyms: SLEB1 TIL3
UniProtKB ID: O60602, B1AZ05, B3Y633, D3DTB8, O15456, Q32MI3
Gene ID:
Human(7100) Summary: This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
Mouse(53791) toll-like receptor 5
Rat(289337) toll-like receptor 5
chicken(554217) toll-like receptor 5
domestic cat(101082202) toll-like receptor 5
dog(488605) toll-like receptor 5
cow(444870) toll-like receptor 5
Goat(100860844) toll-like receptor 5
sheep(554256) toll-like receptor 5
naked mole-rat(101719481) toll-like receptor 5
Gene Class: Cytoskeleton
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003268 Rosetta Predictions human pricing
XM_001063885 Rosetta Predictions rat pricing
XM_223016 Rosetta Predictions rat pricing
NM_016928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050105 predicted 1359
2 SASI_Hs01_00050106 predicted 2803
3 SASI_Hs02_00335322 predicted 2591
4 SASI_Hs01_00050107 predicted 1557
5 SASI_Hs01_00050108 predicted 2412
6 SASI_Hs02_00335323 predicted 1689
7 SASI_Hs01_00050111 predicted 2533
8 SASI_Hs01_00050112 predicted 711
9 SASI_Hs01_00050113 predicted 2754
10 SASI_Hs02_00335324 predicted 2518
11 SASI_Hs01_00050104 predicted 1016
12 SASI_Hs01_00050109 predicted 2465
13 SASI_Hs01_00050110 predicted 2055
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308602 predicted 2053
2 SASI_Rn02_00308603 predicted 1601
3 SASI_Rn02_00308604 predicted 236
4 SASI_Rn02_00308605 predicted 1941
5 SASI_Rn02_00308606 predicted 1637
6 SASI_Rn02_00308607 predicted 395
7 SASI_Rn02_00308608 predicted 2392
8 SASI_Rn02_00308609 predicted 1648
9 SASI_Rn02_00308610 predicted 1963
10 SASI_Rn02_00308611 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381074 predicted 2054
2 SASI_Rn02_00381075 predicted 1598
3 SASI_Rn02_00381076 predicted 231
4 SASI_Rn02_00381077 predicted 1946
5 SASI_Rn02_00381078 predicted 1642
6 SASI_Rn02_00381079 predicted 399
7 SASI_Rn02_00381080 predicted 2388
8 SASI_Rn02_00381081 predicted 1651
9 SASI_Rn02_00381082 predicted 1956
10 SASI_Rn02_00381083 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323791 predicted 1452
2 SASI_Mm02_00323792 predicted 612
3 SASI_Mm02_00323793 predicted 724
4 SASI_Mm02_00323794 predicted 1969
5 SASI_Mm02_00323795 predicted 1914
6 SASI_Mm02_00323796 predicted 1981
7 SASI_Mm02_00323797 predicted 2430
8 SASI_Mm02_00323798 predicted 2479
9 SASI_Mm02_00323799 predicted 1954
10 SASI_Mm02_00323800 predicted 2743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003268
TLR5 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003268.5-1546s21c1
Sequence:CCGGCCCTGAACTCACGAGTCTTTGCTCGAGCAAAGACTCGTGAGTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003268.5-1042s21c1
Sequence:CCGGCTGTATTGAAAGATGGTTATTCTCGAGAATAACCATCTTTCAATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003268.5-2350s21c1
Sequence:CCGGCACTTAGTGTCTTGGATATAACTCGAGTTATATCCAAGACACTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003268.5-3499s21c1
Sequence:CCGGGATTATGGAATGTATCCTAATCTCGAGATTAGGATACATTCCATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003268.3-2971s1c1
Sequence:CCGGGCAGGTGCTTATCTGACCTTACTCGAGTAAGGTCAGATAAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003268.3-2023s1c1
Sequence:CCGGCCTCCTGTAGTGGAGATCAAACTCGAGTTTGATCTCCACTACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003268.3-944s1c1
Sequence:CCGGCCTGGGAAGTAGTAAGATATACTCGAGTATATCTTACTACTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003268
TLR5 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003268.5-1546s21c1
Sequence:CCGGCCCTGAACTCACGAGTCTTTGCTCGAGCAAAGACTCGTGAGTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003268.5-1042s21c1
Sequence:CCGGCTGTATTGAAAGATGGTTATTCTCGAGAATAACCATCTTTCAATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003268.5-2350s21c1
Sequence:CCGGCACTTAGTGTCTTGGATATAACTCGAGTTATATCCAAGACACTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003268.5-3499s21c1
Sequence:CCGGGATTATGGAATGTATCCTAATCTCGAGATTAGGATACATTCCATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003268.3-2971s1c1
Sequence:CCGGGCAGGTGCTTATCTGACCTTACTCGAGTAAGGTCAGATAAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003268.3-2023s1c1
Sequence:CCGGCCTCCTGTAGTGGAGATCAAACTCGAGTTTGATCTCCACTACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003268.3-944s1c1
Sequence:CCGGCCTGGGAAGTAGTAAGATATACTCGAGTATATCTTACTACTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003268
TLR5 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003268.5-1546s21c1
Sequence:CCGGCCCTGAACTCACGAGTCTTTGCTCGAGCAAAGACTCGTGAGTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003268.5-1042s21c1
Sequence:CCGGCTGTATTGAAAGATGGTTATTCTCGAGAATAACCATCTTTCAATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003268.5-2350s21c1
Sequence:CCGGCACTTAGTGTCTTGGATATAACTCGAGTTATATCCAAGACACTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003268.5-3499s21c1
Sequence:CCGGGATTATGGAATGTATCCTAATCTCGAGATTAGGATACATTCCATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003268.3-2971s1c1
Sequence:CCGGGCAGGTGCTTATCTGACCTTACTCGAGTAAGGTCAGATAAGCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003268.3-2023s1c1
Sequence:CCGGCCTCCTGTAGTGGAGATCAAACTCGAGTTTGATCTCCACTACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003268.3-944s1c1
Sequence:CCGGCCTGGGAAGTAGTAAGATATACTCGAGTATATCTTACTACTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016928
TLR5 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016928.2-2805s21c1
Sequence:CCGGGTTGGCTGGTTTCTCGATAAACTCGAGTTTATCGAGAAACCAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016928.2-2298s21c1
Sequence:CCGGATCACCCTTGTAGTCATAAAGCTCGAGCTTTATGACTACAAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016928.2-2944s21c1
Sequence:CCGGAGATAACTCTCCACGCTTTATCTCGAGATAAAGCGTGGAGAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-2525s1c1
Sequence:CCGGCCTGAGTAATAACTACCTTAACTCGAGTTAAGGTAGTTATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-1892s1c1
Sequence:CCGGCGGCTTTATCTTCTCCTTGAACTCGAGTTCAAGGAGAAGATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-2629s1c1
Sequence:CCGGCGGGCAGTTTACCTGCTAATTCTCGAGAATTAGCAGGTAAACTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-1269s1c1
Sequence:CCGGGCTTTCAGAAACCTGCCCAATCTCGAGATTGGGCAGGTTTCTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-1415s1c1
Sequence:CCGGCGGTTACTTCAGAAATCTATACTCGAGTATAGATTTCTGAAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016928
TLR5 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016928.2-2805s21c1
Sequence:CCGGGTTGGCTGGTTTCTCGATAAACTCGAGTTTATCGAGAAACCAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016928.2-2298s21c1
Sequence:CCGGATCACCCTTGTAGTCATAAAGCTCGAGCTTTATGACTACAAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016928.2-2944s21c1
Sequence:CCGGAGATAACTCTCCACGCTTTATCTCGAGATAAAGCGTGGAGAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-2525s1c1
Sequence:CCGGCCTGAGTAATAACTACCTTAACTCGAGTTAAGGTAGTTATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-1892s1c1
Sequence:CCGGCGGCTTTATCTTCTCCTTGAACTCGAGTTCAAGGAGAAGATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-2629s1c1
Sequence:CCGGCGGGCAGTTTACCTGCTAATTCTCGAGAATTAGCAGGTAAACTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-1269s1c1
Sequence:CCGGGCTTTCAGAAACCTGCCCAATCTCGAGATTGGGCAGGTTTCTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-1415s1c1
Sequence:CCGGCGGTTACTTCAGAAATCTATACTCGAGTATAGATTTCTGAAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016928
TLR5 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016928.2-2805s21c1
Sequence:CCGGGTTGGCTGGTTTCTCGATAAACTCGAGTTTATCGAGAAACCAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016928.2-2298s21c1
Sequence:CCGGATCACCCTTGTAGTCATAAAGCTCGAGCTTTATGACTACAAGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016928.2-2944s21c1
Sequence:CCGGAGATAACTCTCCACGCTTTATCTCGAGATAAAGCGTGGAGAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-2525s1c1
Sequence:CCGGCCTGAGTAATAACTACCTTAACTCGAGTTAAGGTAGTTATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-1892s1c1
Sequence:CCGGCGGCTTTATCTTCTCCTTGAACTCGAGTTCAAGGAGAAGATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-2629s1c1
Sequence:CCGGCGGGCAGTTTACCTGCTAATTCTCGAGAATTAGCAGGTAAACTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-1269s1c1
Sequence:CCGGGCTTTCAGAAACCTGCCCAATCTCGAGATTGGGCAGGTTTCTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016928.1-1415s1c1
Sequence:CCGGCGGTTACTTCAGAAATCTATACTCGAGTATAGATTTCTGAAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks