EMAIL THIS PAGE TO A FRIEND

TLR6

toll-like receptor 6

Synonyms: CD286
UniProtKB ID: Q9Y2C9, B3Y640, B6CH35, B6RFS4, B6RFS5
Gene ID:
Human(10333) Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor functionally interacts with toll-like receptor 2 to mediate cellular response to bacterial lipoproteins. A Ser249Pro polymorphism in the extracellular domain of the encoded protein may be associated with an increased of asthma is some populations.[provided by RefSeq, Jan 2011]
Mouse(21899) toll-like receptor 6
Rat(305353) toll-like receptor 6
domestic cat(493662) toll-like receptor 6
Horse(100064554) toll-like receptor 6
dog(100684818) toll-like receptor 6
domestic guinea pig(100733137) toll-like receptor 6
naked mole-rat(101718313) toll-like receptor 6
Domestic Rabbit(100353753) toll-like receptor 6
cow(407237) toll-like receptor 6
Goat(100860932) toll-like receptor 6
sheep(554257) toll-like receptor 6
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300203 Anti-Mouse Tlr6 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1300202 Anti-Mouse Tlr6 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
PRS3651 Anti-TLR6 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, western blot pricing
PRS3653 Anti-TLR6 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412104 ANTI-TLR6 antibody produced in mouse clone 1A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412363 ANTI-TLR6 antibody produced in mouse clone 3D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412364 ANTI-TLR6 antibody produced in mouse clone 3D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412365 ANTI-TLR6 antibody produced in mouse clone 4F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412366 ANTI-TLR6 antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412500 ANTI-TLR6 antibody produced in mouse clone 1C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412501 ANTI-TLR6 antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412502 ANTI-TLR6 antibody produced in mouse clone 2B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412522 ANTI-TLR6 antibody produced in mouse clone 4H3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV31755 Anti-TLR6 antibody produced in rabbit affinity isolated antibody sheep, goat, human
immunohistochemistry, western blot pricing
HPA062733 Anti-TLR6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0010333M1 Monoclonal Anti-TLR6 antibody produced in mouse clone 4E4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404815 Monoclonal Anti-TLR6 antibody produced in mouse clone 2B3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006068 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006068 Rosetta Predictions human pricing
NM_207604 Rosetta Predictions rat pricing
NM_011604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162170 predicted 756
2 SASI_Hs01_00162171 predicted 2010
3 SASI_Hs01_00162172 predicted 726
4 SASI_Hs01_00162174 predicted 345
5 SASI_Hs02_00340835 predicted 317
6 SASI_Hs01_00162176 predicted 2505
7 SASI_Hs01_00162177 predicted 675
8 SASI_Hs02_00340836 predicted 240
9 SASI_Hs01_00162179 predicted 403
10 SASI_Hs02_00340837 predicted 495
11 SASI_Hs01_00162173 predicted 1295
12 SASI_Hs01_00162175 predicted 491
13 SASI_Hs01_00162178 predicted 2477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065560 predicted 936
2 SASI_Rn01_00065562 predicted 1138
3 SASI_Rn02_00270429 predicted 646
4 SASI_Rn01_00065563 predicted 911
5 SASI_Rn02_00270430 predicted 1195
6 SASI_Rn01_00065564 predicted 1827
7 SASI_Rn01_00065565 predicted 1869
8 SASI_Rn02_00270431 predicted 1207
9 SASI_Rn01_00065566 predicted 2223
10 SASI_Rn01_00065568 predicted 1938
11 SASI_Rn01_00065561 predicted 1224
12 SASI_Rn01_00065567 predicted 947
13 SASI_Rn01_00065569 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041584 predicted 1229
2 SASI_Mm01_00041585 predicted 1543
3 SASI_Mm01_00041587 predicted 1457
4 SASI_Mm01_00041588 predicted 1077
5 SASI_Mm01_00041589 predicted 258
6 SASI_Mm02_00321019 predicted 2096
7 SASI_Mm01_00041591 predicted 1606
8 SASI_Mm01_00041592 predicted 1758
9 SASI_Mm01_00041593 predicted 528
10 SASI_Mm02_00321020 predicted 2109
11 SASI_Mm01_00041586 predicted 2263
12 SASI_Mm01_00041590 predicted 2315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011604
TLR6 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-628s1c1
Sequence:CCGGCCTGGGATTAAGTGCTGCAAACTCGAGTTTGCAGCACTTAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-2390s1c1
Sequence:CCGGCCCATTCTACAGAACAACATTCTCGAGAATGTTGTTCTGTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-1460s1c1
Sequence:CCGGGAGAGCATATTGGTGTTGAATCTCGAGATTCAACACCAATATGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-1007s1c1
Sequence:CCGGCCGGTGGAGTACCTCAATATTCTCGAGAATATTGAGGTACTCCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-557s1c1
Sequence:CCGGGACCTCTCATTCAATGACTTTCTCGAGAAAGTCATTGAATGAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011604.3-900s21c1
Sequence:CCGGCACCAGAGGTCCAACCTTATTCTCGAGAATAAGGTTGGACCTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011604.3-1130s21c1
Sequence:CCGGAGGCGCTATACTCGGTGTTTGCTCGAGCAAACACCGAGTATAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011604.3-694s21c1
Sequence:CCGGGACTTAGTGAGTTATCATATACTCGAGTATATGATAACTCACTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011604
TLR6 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-628s1c1
Sequence:CCGGCCTGGGATTAAGTGCTGCAAACTCGAGTTTGCAGCACTTAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-2390s1c1
Sequence:CCGGCCCATTCTACAGAACAACATTCTCGAGAATGTTGTTCTGTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-1460s1c1
Sequence:CCGGGAGAGCATATTGGTGTTGAATCTCGAGATTCAACACCAATATGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-1007s1c1
Sequence:CCGGCCGGTGGAGTACCTCAATATTCTCGAGAATATTGAGGTACTCCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-557s1c1
Sequence:CCGGGACCTCTCATTCAATGACTTTCTCGAGAAAGTCATTGAATGAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011604.3-900s21c1
Sequence:CCGGCACCAGAGGTCCAACCTTATTCTCGAGAATAAGGTTGGACCTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011604.3-1130s21c1
Sequence:CCGGAGGCGCTATACTCGGTGTTTGCTCGAGCAAACACCGAGTATAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011604.3-694s21c1
Sequence:CCGGGACTTAGTGAGTTATCATATACTCGAGTATATGATAACTCACTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011604
TLR6 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-628s1c1
Sequence:CCGGCCTGGGATTAAGTGCTGCAAACTCGAGTTTGCAGCACTTAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-2390s1c1
Sequence:CCGGCCCATTCTACAGAACAACATTCTCGAGAATGTTGTTCTGTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-1460s1c1
Sequence:CCGGGAGAGCATATTGGTGTTGAATCTCGAGATTCAACACCAATATGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-1007s1c1
Sequence:CCGGCCGGTGGAGTACCTCAATATTCTCGAGAATATTGAGGTACTCCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011604.2-557s1c1
Sequence:CCGGGACCTCTCATTCAATGACTTTCTCGAGAAAGTCATTGAATGAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011604.3-900s21c1
Sequence:CCGGCACCAGAGGTCCAACCTTATTCTCGAGAATAAGGTTGGACCTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011604.3-1130s21c1
Sequence:CCGGAGGCGCTATACTCGGTGTTTGCTCGAGCAAACACCGAGTATAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011604.3-694s21c1
Sequence:CCGGGACTTAGTGAGTTATCATATACTCGAGTATATGATAACTCACTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006068
TLR6 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-471s1c1
Sequence:CCGGCCTGCCCATCTGTAAGGAATTCTCGAGAATTCCTTACAGATGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-860s1c1
Sequence:CCGGGCCTGGTCAGAGTCTTTCAATCTCGAGATTGAAAGACTCTGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-837s1c1
Sequence:CCGGCCACATAGAAACGACTTGGAACTCGAGTTCCAAGTCGTTTCTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-2278s1c1
Sequence:CCGGCCCATTCCACAGAACAGCATTCTCGAGAATGCTGTTCTGTGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-1273s1c1
Sequence:CCGGCCTTCTTTGGAAATACTGGATCTCGAGATCCAGTATTTCCAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-699s21c1
Sequence:CCGGCCAAGTGAACATATCAGTTAACTCGAGTTAACTGATATGTTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-1309s21c1
Sequence:CCGGTTGGAATCTGGTAGACATAAACTCGAGTTTATGTCTACCAGATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-2328s21c1
Sequence:CCGGCATGACGCAGCGGACTTATTTCTCGAGAAATAAGTCCGCTGCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-565s21c1
Sequence:CCGGGCTCACTTGCATCTAAGTTATCTCGAGATAACTTAGATGCAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006068
TLR6 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-471s1c1
Sequence:CCGGCCTGCCCATCTGTAAGGAATTCTCGAGAATTCCTTACAGATGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-860s1c1
Sequence:CCGGGCCTGGTCAGAGTCTTTCAATCTCGAGATTGAAAGACTCTGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-837s1c1
Sequence:CCGGCCACATAGAAACGACTTGGAACTCGAGTTCCAAGTCGTTTCTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-2278s1c1
Sequence:CCGGCCCATTCCACAGAACAGCATTCTCGAGAATGCTGTTCTGTGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-1273s1c1
Sequence:CCGGCCTTCTTTGGAAATACTGGATCTCGAGATCCAGTATTTCCAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-699s21c1
Sequence:CCGGCCAAGTGAACATATCAGTTAACTCGAGTTAACTGATATGTTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-1309s21c1
Sequence:CCGGTTGGAATCTGGTAGACATAAACTCGAGTTTATGTCTACCAGATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-2328s21c1
Sequence:CCGGCATGACGCAGCGGACTTATTTCTCGAGAAATAAGTCCGCTGCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-565s21c1
Sequence:CCGGGCTCACTTGCATCTAAGTTATCTCGAGATAACTTAGATGCAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006068
TLR6 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-471s1c1
Sequence:CCGGCCTGCCCATCTGTAAGGAATTCTCGAGAATTCCTTACAGATGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-860s1c1
Sequence:CCGGGCCTGGTCAGAGTCTTTCAATCTCGAGATTGAAAGACTCTGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-837s1c1
Sequence:CCGGCCACATAGAAACGACTTGGAACTCGAGTTCCAAGTCGTTTCTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-2278s1c1
Sequence:CCGGCCCATTCCACAGAACAGCATTCTCGAGAATGCTGTTCTGTGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006068.2-1273s1c1
Sequence:CCGGCCTTCTTTGGAAATACTGGATCTCGAGATCCAGTATTTCCAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-699s21c1
Sequence:CCGGCCAAGTGAACATATCAGTTAACTCGAGTTAACTGATATGTTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-1309s21c1
Sequence:CCGGTTGGAATCTGGTAGACATAAACTCGAGTTTATGTCTACCAGATTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-2328s21c1
Sequence:CCGGCATGACGCAGCGGACTTATTTCTCGAGAAATAAGTCCGCTGCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006068.2-565s21c1
Sequence:CCGGGCTCACTTGCATCTAAGTTATCTCGAGATAACTTAGATGCAAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks