EMAIL THIS PAGE TO A FRIEND

TLR7

toll-like receptor 7

Synonyms: TLR7-like
UniProtKB ID: Q9NYK1, D1CS69, Q9NR98
Gene ID:
Human(51284) Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung, placenta, and spleen, and lies in close proximity to another family member, TLR8, on chromosome X. [provided by RefSeq, Jul 2008]
Mouse(170743) toll-like receptor 7
Rat(317468) toll-like receptor 7
cow(493686) toll-like receptor 7
sheep(554254) toll-like receptor 7
Goat(100860934) toll-like receptor 7
naked mole-rat(101705918) toll-like receptor 7
domestic guinea pig(100713329) toll-like receptor 7
Zebrafish(100534776) toll-like receptor 7
Horse(791248) toll-like receptor 7
domestic cat(493685) toll-like receptor 7
chicken(418638) toll-like receptor 7
dog(491743) toll-like receptor 7
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016562 Rosetta Predictions human pricing
NM_001097582 Rosetta Predictions rat pricing
NM_133211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349690 predicted 2011
2 SASI_Hs01_00079250 predicted 2284
3 SASI_Hs01_00079251 predicted 878
4 SASI_Hs01_00079252 predicted 1781
5 SASI_Hs02_00349691 predicted 1742
6 SASI_Hs01_00079254 predicted 1371
7 SASI_Hs01_00079256 predicted 472
8 SASI_Hs01_00079257 predicted 904
9 SASI_Hs01_00079258 predicted 496
10 SASI_Hs01_00079259 predicted 1911
11 SASI_Hs01_00079253 predicted 1724
12 SASI_Hs01_00079255 predicted 2934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209081 predicted 1650
2 SASI_Rn02_00209082 predicted 1856
3 SASI_Rn02_00209083 predicted 1334
4 SASI_Rn02_00209084 predicted 2104
5 SASI_Rn02_00209085 predicted 2623
6 SASI_Rn02_00209086 predicted 2720
7 SASI_Rn02_00209087 predicted 2021
8 SASI_Rn02_00209088 predicted 2289
9 SASI_Rn02_00209089 predicted 919
10 SASI_Rn02_00209090 predicted 2404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199945 predicted 849
2 SASI_Mm01_00199946 predicted 955
3 SASI_Mm01_00199947 predicted 1665
4 SASI_Mm01_00199948 predicted 2842
5 SASI_Mm01_00199949 predicted 2334
6 SASI_Mm02_00338405 predicted 1032
7 SASI_Mm01_00199950 predicted 3291
8 SASI_Mm01_00199952 predicted 2440
9 SASI_Mm01_00199953 predicted 2133
10 SASI_Mm02_00338406 predicted 1935
11 SASI_Mm01_00199951 predicted 1469
12 SASI_Mm01_00199954 predicted 2110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016562
TLR7 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016562.3-2343s21c1
Sequence:CCGGTCAGGAGTCTGACGAAGTATTCTCGAGAATACTTCGTCAGACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016562.3-3394s21c1
Sequence:CCGGGAAATGAGATTGCCCATATTTCTCGAGAAATATGGGCAATCTCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016562.3-1625s21c1
Sequence:CCGGCAGACCTTGGATCTAAGTAAACTCGAGTTTACTTAGATCCAAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016562.3-2535s21c1
Sequence:CCGGACCATACGGAGGTGACTATTCCTCGAGGAATAGTCACCTCCGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-2193s1c1
Sequence:CCGGGCTCAAATCTTTCAGTTGGAACTCGAGTTCCAACTGAAAGATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-759s1c1
Sequence:CCGGGCTCTCCCTGAAAGATAACAACTCGAGTTGTTATCTTTCAGGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-1549s1c1
Sequence:CCGGGCAAGGAGTTGCAGATTCAAACTCGAGTTTGAATCTGCAACTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-2967s1c1
Sequence:CCGGCCAGAGCATACAGCTTAGCAACTCGAGTTGCTAAGCTGTATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-2630s1c1
Sequence:CCGGCCTGTGAGTTAGATCTGACTACTCGAGTAGTCAGATCTAACTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016562
TLR7 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016562.3-2343s21c1
Sequence:CCGGTCAGGAGTCTGACGAAGTATTCTCGAGAATACTTCGTCAGACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016562.3-3394s21c1
Sequence:CCGGGAAATGAGATTGCCCATATTTCTCGAGAAATATGGGCAATCTCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016562.3-1625s21c1
Sequence:CCGGCAGACCTTGGATCTAAGTAAACTCGAGTTTACTTAGATCCAAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016562.3-2535s21c1
Sequence:CCGGACCATACGGAGGTGACTATTCCTCGAGGAATAGTCACCTCCGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-2193s1c1
Sequence:CCGGGCTCAAATCTTTCAGTTGGAACTCGAGTTCCAACTGAAAGATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-759s1c1
Sequence:CCGGGCTCTCCCTGAAAGATAACAACTCGAGTTGTTATCTTTCAGGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-1549s1c1
Sequence:CCGGGCAAGGAGTTGCAGATTCAAACTCGAGTTTGAATCTGCAACTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-2967s1c1
Sequence:CCGGCCAGAGCATACAGCTTAGCAACTCGAGTTGCTAAGCTGTATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-2630s1c1
Sequence:CCGGCCTGTGAGTTAGATCTGACTACTCGAGTAGTCAGATCTAACTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016562
TLR7 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016562.3-2343s21c1
Sequence:CCGGTCAGGAGTCTGACGAAGTATTCTCGAGAATACTTCGTCAGACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016562.3-3394s21c1
Sequence:CCGGGAAATGAGATTGCCCATATTTCTCGAGAAATATGGGCAATCTCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016562.3-1625s21c1
Sequence:CCGGCAGACCTTGGATCTAAGTAAACTCGAGTTTACTTAGATCCAAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016562.3-2535s21c1
Sequence:CCGGACCATACGGAGGTGACTATTCCTCGAGGAATAGTCACCTCCGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-2193s1c1
Sequence:CCGGGCTCAAATCTTTCAGTTGGAACTCGAGTTCCAACTGAAAGATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-759s1c1
Sequence:CCGGGCTCTCCCTGAAAGATAACAACTCGAGTTGTTATCTTTCAGGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-1549s1c1
Sequence:CCGGGCAAGGAGTTGCAGATTCAAACTCGAGTTTGAATCTGCAACTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-2967s1c1
Sequence:CCGGCCAGAGCATACAGCTTAGCAACTCGAGTTGCTAAGCTGTATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016562.2-2630s1c1
Sequence:CCGGCCTGTGAGTTAGATCTGACTACTCGAGTAGTCAGATCTAACTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133211
TLR7 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-1248s21c1
Sequence:CCGGCAGGTCTACCATGCATCTATACTCGAGTATAGATGCATGGTAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-2090s21c1
Sequence:CCGGTCTATGGAGAGCCGGTGATAACTCGAGTTATCACCGGCTCTCCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-456s21c1
Sequence:CCGGCATCTGGAAGAAATCGATTTACTCGAGTAAATCGATTTCTTCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-849s21c1
Sequence:CCGGACCACTTTGCCACCTAATTTACTCGAGTAAATTAGGTGGCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133211.2-3404s1c1
Sequence:CCGGCCATAAATGAAGGTCTGAATTCTCGAGAATTCAGACCTTCATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-2742s1c1
Sequence:CCGGCCTCTTTCTTATGGTAGTTATCTCGAGATAACTACCATAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-2075s1c1
Sequence:CCGGGCAACCATTTAGATGTTCTATCTCGAGATAGAACATCTAAATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-3172s1c1
Sequence:CCGGCCTCTTCAGAAGTCTAAGTTTCTCGAGAAACTTAGACTTCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-1021s1c1
Sequence:CCGGCCCTTACAGATCCATGACAATCTCGAGATTGTCATGGATCTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133211
TLR7 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-1248s21c1
Sequence:CCGGCAGGTCTACCATGCATCTATACTCGAGTATAGATGCATGGTAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-2090s21c1
Sequence:CCGGTCTATGGAGAGCCGGTGATAACTCGAGTTATCACCGGCTCTCCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-456s21c1
Sequence:CCGGCATCTGGAAGAAATCGATTTACTCGAGTAAATCGATTTCTTCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-849s21c1
Sequence:CCGGACCACTTTGCCACCTAATTTACTCGAGTAAATTAGGTGGCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133211.2-3404s1c1
Sequence:CCGGCCATAAATGAAGGTCTGAATTCTCGAGAATTCAGACCTTCATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-2742s1c1
Sequence:CCGGCCTCTTTCTTATGGTAGTTATCTCGAGATAACTACCATAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-2075s1c1
Sequence:CCGGGCAACCATTTAGATGTTCTATCTCGAGATAGAACATCTAAATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-3172s1c1
Sequence:CCGGCCTCTTCAGAAGTCTAAGTTTCTCGAGAAACTTAGACTTCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-1021s1c1
Sequence:CCGGCCCTTACAGATCCATGACAATCTCGAGATTGTCATGGATCTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133211
TLR7 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-1248s21c1
Sequence:CCGGCAGGTCTACCATGCATCTATACTCGAGTATAGATGCATGGTAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-2090s21c1
Sequence:CCGGTCTATGGAGAGCCGGTGATAACTCGAGTTATCACCGGCTCTCCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-456s21c1
Sequence:CCGGCATCTGGAAGAAATCGATTTACTCGAGTAAATCGATTTCTTCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133211.3-849s21c1
Sequence:CCGGACCACTTTGCCACCTAATTTACTCGAGTAAATTAGGTGGCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133211.2-3404s1c1
Sequence:CCGGCCATAAATGAAGGTCTGAATTCTCGAGAATTCAGACCTTCATTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-2742s1c1
Sequence:CCGGCCTCTTTCTTATGGTAGTTATCTCGAGATAACTACCATAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-2075s1c1
Sequence:CCGGGCAACCATTTAGATGTTCTATCTCGAGATAGAACATCTAAATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-3172s1c1
Sequence:CCGGCCTCTTCAGAAGTCTAAGTTTCTCGAGAAACTTAGACTTCTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133211.2-1021s1c1
Sequence:CCGGCCCTTACAGATCCATGACAATCTCGAGATTGTCATGGATCTGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks