EMAIL THIS PAGE TO A FRIEND

TLR8

toll-like receptor 8

Synonyms: CD288
UniProtKB ID: Q9NR97, B3Y654, Q495P4, Q6UXL6, Q9NYG9
Gene ID:
Human(51311) Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is predominantly expressed in lung and peripheral blood leukocytes, and lies in close proximity to another family member, TLR7, on chromosome X. [provided by RefSeq, Jul 2008]
Mouse(170744) toll-like receptor 8
Rat(684440) toll-like receptor 8
Zebrafish(100334317) toll-like receptor 8
dog(100684828) toll-like receptor 8
Horse(100054367) toll-like receptor 8
domestic cat(493658) toll-like receptor 8
domestic guinea pig(100713058) toll-like receptor 8
naked mole-rat(101726643) toll-like receptor 8
Domestic Rabbit(100328930) toll-like receptor 8
cow(532262) toll-like receptor 8
sheep(554259) toll-like receptor 8
Goat(100860909) toll-like receptor 8
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016610 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138636 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016610 Rosetta Predictions human pricing
NM_138636 Rosetta Predictions human pricing
NM_001101009 Rosetta Predictions rat pricing
NM_133212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064920 predicted 2481
2 SASI_Hs01_00064921 predicted 2679
3 SASI_Hs01_00064922 predicted 1987
4 SASI_Hs01_00064923 predicted 905
5 SASI_Hs01_00064924 predicted 2212
6 SASI_Hs01_00064925 predicted 626
7 SASI_Hs01_00064926 predicted 2655
8 SASI_Hs01_00064927 predicted 2366
9 SASI_Hs01_00064928 predicted 803
10 SASI_Hs01_00064929 predicted 2665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363771 predicted 556
2 SASI_Hs02_00363772 predicted 1672
3 SASI_Hs01_00074144 predicted 2536
4 SASI_Hs01_00074146 predicted 763
5 SASI_Hs01_00074149 predicted 2512
6 SASI_Hs01_00074150 predicted 2225
7 SASI_Hs01_00074151 predicted 663
8 SASI_Hs01_00074152 predicted 2520
9 SASI_Hs02_00363773 predicted 2172
10 SASI_Hs02_00363774 predicted 1378
11 SASI_Hs01_00074143 predicted 2346
12 SASI_Hs01_00074145 predicted 1850
13 SASI_Hs01_00074147 predicted 2067
14 SASI_Hs01_00074148 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211216 predicted 770
2 SASI_Rn02_00211217 predicted 582
3 SASI_Rn02_00211218 predicted 1304
4 SASI_Rn02_00211219 predicted 2030
5 SASI_Rn02_00211220 predicted 2872
6 SASI_Rn02_00211221 predicted 2917
7 SASI_Rn02_00211222 predicted 2579
8 SASI_Rn02_00211223 predicted 2216
9 SASI_Rn02_00211224 predicted 1083
10 SASI_Rn02_00211225 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063246 predicted 671
2 SASI_Mm02_00338407 predicted 2230
3 SASI_Mm01_00063247 predicted 1273
4 SASI_Mm01_00063248 predicted 2773
5 SASI_Mm01_00063249 predicted 1208
6 SASI_Mm01_00063250 predicted 2388
7 SASI_Mm01_00063251 predicted 1120
8 SASI_Mm01_00063252 predicted 255
9 SASI_Mm01_00063254 predicted 2444
10 SASI_Mm02_00338408 predicted 1376
11 SASI_Mm01_00063245 predicted 510
12 SASI_Mm01_00063253 predicted 2147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133212
TLR8 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-1053s1c1
Sequence:CCGGCCAGTTTACAAATCCTTGATTCTCGAGAATCAAGGATTTGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-2659s1c1
Sequence:CCGGCCAAACTTTCTATGATGCTTACTCGAGTAAGCATCATAGAAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-1958s1c1
Sequence:CCGGCGCCTGGACTTATCATACAATCTCGAGATTGTATGATAAGTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-414s1c1
Sequence:CCGGGCCTAAGAAATCTAACAGTTTCTCGAGAAACTGTTAGATTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-1232s1c1
Sequence:CCGGGCAACCATCAACTTGGGCATTCTCGAGAATGCCCAAGTTGATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-1390s21c1
Sequence:CCGGGTTTGATCCACACGTGAATTTCTCGAGAAATTCACGTGTGGATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-1275s21c1
Sequence:CCGGCCAAACTCGACGTTATCTATTCTCGAGAATAGATAACGTCGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-2084s21c1
Sequence:CCGGTTGCTGGATTTATCGAGAAATCTCGAGATTTCTCGATAAATCCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-135s21c1
Sequence:CCGGGCTATCCTTGTGACGAGATAACTCGAGTTATCTCGTCACAAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133212
TLR8 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-1053s1c1
Sequence:CCGGCCAGTTTACAAATCCTTGATTCTCGAGAATCAAGGATTTGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-2659s1c1
Sequence:CCGGCCAAACTTTCTATGATGCTTACTCGAGTAAGCATCATAGAAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-1958s1c1
Sequence:CCGGCGCCTGGACTTATCATACAATCTCGAGATTGTATGATAAGTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-414s1c1
Sequence:CCGGGCCTAAGAAATCTAACAGTTTCTCGAGAAACTGTTAGATTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-1232s1c1
Sequence:CCGGGCAACCATCAACTTGGGCATTCTCGAGAATGCCCAAGTTGATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-1390s21c1
Sequence:CCGGGTTTGATCCACACGTGAATTTCTCGAGAAATTCACGTGTGGATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-1275s21c1
Sequence:CCGGCCAAACTCGACGTTATCTATTCTCGAGAATAGATAACGTCGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-2084s21c1
Sequence:CCGGTTGCTGGATTTATCGAGAAATCTCGAGATTTCTCGATAAATCCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-135s21c1
Sequence:CCGGGCTATCCTTGTGACGAGATAACTCGAGTTATCTCGTCACAAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133212
TLR8 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-1053s1c1
Sequence:CCGGCCAGTTTACAAATCCTTGATTCTCGAGAATCAAGGATTTGTAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-2659s1c1
Sequence:CCGGCCAAACTTTCTATGATGCTTACTCGAGTAAGCATCATAGAAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-1958s1c1
Sequence:CCGGCGCCTGGACTTATCATACAATCTCGAGATTGTATGATAAGTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-414s1c1
Sequence:CCGGGCCTAAGAAATCTAACAGTTTCTCGAGAAACTGTTAGATTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133212.1-1232s1c1
Sequence:CCGGGCAACCATCAACTTGGGCATTCTCGAGAATGCCCAAGTTGATGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-1390s21c1
Sequence:CCGGGTTTGATCCACACGTGAATTTCTCGAGAAATTCACGTGTGGATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-1275s21c1
Sequence:CCGGCCAAACTCGACGTTATCTATTCTCGAGAATAGATAACGTCGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-2084s21c1
Sequence:CCGGTTGCTGGATTTATCGAGAAATCTCGAGATTTCTCGATAAATCCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133212.2-135s21c1
Sequence:CCGGGCTATCCTTGTGACGAGATAACTCGAGTTATCTCGTCACAAGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016610
TLR8 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 8
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000056958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016610.2-1216s1c1
Sequence:CCGGCCGCTTAGAAATACTTGACTTCTCGAGAAGTCAAGTATTTCTAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016610.2-3310s1c1
Sequence:CCGGCGATTCCATTAAGCAATACTACTCGAGTAGTATTGCTTAATGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016610.2-2132s1c1
Sequence:CCGGCGTCTGGATTTATCCCTTAATCTCGAGATTAAGGGATAAATCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016610
TLR8 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 8
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000056958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016610.2-1216s1c1
Sequence:CCGGCCGCTTAGAAATACTTGACTTCTCGAGAAGTCAAGTATTTCTAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016610.2-3310s1c1
Sequence:CCGGCGATTCCATTAAGCAATACTACTCGAGTAGTATTGCTTAATGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016610.2-2132s1c1
Sequence:CCGGCGTCTGGATTTATCCCTTAATCTCGAGATTAAGGGATAAATCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016610
TLR8 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 8
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000056958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016610.2-1216s1c1
Sequence:CCGGCCGCTTAGAAATACTTGACTTCTCGAGAAGTCAAGTATTTCTAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016610.2-3310s1c1
Sequence:CCGGCGATTCCATTAAGCAATACTACTCGAGTAGTATTGCTTAATGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016610.2-2132s1c1
Sequence:CCGGCGTCTGGATTTATCCCTTAATCTCGAGATTAAGGGATAAATCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138636
TLR8 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 8
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000359318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138636.4-1771s21c1
Sequence:CCGGAGCTATAATTCACACTATTTCCTCGAGGAAATAGTGTGAATTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138636.4-3226s21c1
Sequence:CCGGCATGATTTCGCGCCATAATAACTCGAGTTATTATGGCGCGAAATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138636.4-1139s21c1
Sequence:CCGGGGAGTTATCCACAGCATATTACTCGAGTAATATGCTGTGGATAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138636.4-1278s21c1
Sequence:CCGGGACTATCAACTTGGGTATTAACTCGAGTTAATACCCAAGTTGATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138636
TLR8 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 8
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000359318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138636.4-1771s21c1
Sequence:CCGGAGCTATAATTCACACTATTTCCTCGAGGAAATAGTGTGAATTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138636.4-3226s21c1
Sequence:CCGGCATGATTTCGCGCCATAATAACTCGAGTTATTATGGCGCGAAATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138636.4-1139s21c1
Sequence:CCGGGGAGTTATCCACAGCATATTACTCGAGTAATATGCTGTGGATAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138636.4-1278s21c1
Sequence:CCGGGACTATCAACTTGGGTATTAACTCGAGTTAATACCCAAGTTGATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138636
TLR8 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 8
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000359318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138636.4-1771s21c1
Sequence:CCGGAGCTATAATTCACACTATTTCCTCGAGGAAATAGTGTGAATTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138636.4-3226s21c1
Sequence:CCGGCATGATTTCGCGCCATAATAACTCGAGTTATTATGGCGCGAAATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138636.4-1139s21c1
Sequence:CCGGGGAGTTATCCACAGCATATTACTCGAGTAATATGCTGTGGATAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138636.4-1278s21c1
Sequence:CCGGGACTATCAACTTGGGTATTAACTCGAGTTAATACCCAAGTTGATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks