EMAIL THIS PAGE TO A FRIEND

TLR9

toll-like receptor 9

Synonyms: CD289
Gene ID:
Human(54106) Summary: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
Mouse(81897) toll-like receptor 9
Rat(338457) toll-like receptor 9
Zebrafish(403128) toll-like receptor 9
domestic cat(493839) toll-like receptor 9
Horse(100009693) toll-like receptor 9
dog(403502) toll-like receptor 9
cow(282602) toll-like receptor 9
sheep(494547) toll-like receptor 9
Goat(100860819) toll-like receptor 9
naked mole-rat(101715478) toll-like receptor 9
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301460 ANTI-MOUSE TLR9 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1302745 ANTI-MOUSE TLR9 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
ELISA, immunohistochemistry pricing
SAB1105546 Anti-TLR9 (271-285) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
GW22790 Anti-TLR9 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
SAB1412111 ANTI-TLR9 antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412155 ANTI-TLR9 antibody produced in mouse clone 3B7, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412156 ANTI-TLR9 antibody produced in mouse clone 2H5, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412299 ANTI-TLR9 antibody produced in mouse clone 1E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412300 ANTI-TLR9 antibody produced in mouse clone 2G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412301 ANTI-TLR9 antibody produced in mouse clone 1D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412302 ANTI-TLR9 antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA004731 Anti-TLR9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB3500313 Anti-TLR9 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2104136 Anti-TLR9, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, sheep, pig, rat, guinea pig, bovine, human, mouse, horse, goat
western blot pricing
WH0054106M3 Monoclonal Anti-TLR9 antibody produced in mouse clone 1E8, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB1405118 Monoclonal Anti-TLR9 antibody produced in mouse clone 1F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017442 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017442 Rosetta Predictions human pricing
NM_138688 Rosetta Predictions human pricing
NM_198131 Rosetta Predictions rat pricing
NM_031178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022142 predicted 1643
2 SASI_Hs01_00022143 predicted 2880
3 SASI_Hs01_00022144 predicted 1089
4 SASI_Hs02_00350044 predicted 1478
5 SASI_Hs01_00022147 predicted 2752
6 SASI_Hs01_00022148 predicted 2069
7 SASI_Hs01_00022149 predicted 2164
8 SASI_Hs01_00022150 predicted 2688
9 SASI_Hs02_00350045 predicted 2245
10 SASI_Hs02_00350046 predicted 903
11 SASI_Hs01_00022145 predicted 1057
12 SASI_Hs01_00022146 predicted 1010
13 SASI_Hs01_00022151 predicted 2462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103961 predicted 894
2 SASI_Hs01_00103962 predicted 2125
3 SASI_Hs01_00103963 predicted 336
4 SASI_Hs01_00103964 predicted 298
5 SASI_Hs01_00103965 predicted 250
6 SASI_Hs01_00103966 predicted 1991
7 SASI_Hs01_00103967 predicted 1320
8 SASI_Hs01_00103968 predicted 1404
9 SASI_Hs01_00103969 predicted 1932
10 SASI_Hs01_00103970 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081775 predicted 2701
2 SASI_Rn01_00081776 predicted 2255
3 SASI_Rn01_00081777 predicted 1345
4 SASI_Rn01_00081778 predicted 1496
5 SASI_Rn01_00081779 predicted 2297
6 SASI_Rn01_00081780 predicted 1629
7 SASI_Rn01_00081781 predicted 1345
8 SASI_Rn01_00081782 predicted 2082
9 SASI_Rn01_00081783 predicted 2869
10 SASI_Rn01_00081784 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126147 predicted 2711
2 SASI_Mm01_00126149 predicted 2101
3 SASI_Mm01_00126150 predicted 1792
4 SASI_Mm01_00126151 predicted 1513
5 SASI_Mm01_00126148 predicted 1054
6 SASI_Mm01_00126153 predicted 1353
7 SASI_Mm01_00126154 predicted 1633
8 SASI_Mm01_00126155 predicted 2093
9 SASI_Mm01_00126156 predicted 1855
10 SASI_Mm02_00337014 predicted 2880
11 SASI_Mm01_00126152 predicted 3129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031178
TLR9 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031178.2-485s21c1
Sequence:CCGGGAGCTGAACTTGAGCTATAATCTCGAGATTATAGCTCAAGTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031178.2-3292s21c1
Sequence:CCGGATTTGGCAAGTGCGCAATATACTCGAGTATATTGCGCACTTGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031178.2-1655s21c1
Sequence:CCGGCAGTTCCTGCCGCTGACTAATCTCGAGATTAGTCAGCGGCAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031178.2-776s21c1
Sequence:CCGGTACCTCCTGGTGTCCTATAACCTCGAGGTTATAGGACACCAGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031178.1-3274s1c1
Sequence:CCGGCTGTCTTACTACACCGCTATTCTCGAGAATAGCGGTGTAGTAAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-1171s1c1
Sequence:CCGGCCTGGCAAGTTCCTTCAAGAACTCGAGTTCTTGAAGGAACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-1780s1c1
Sequence:CCGGGCCCTTTAGCATGAAGGGTATCTCGAGATACCCTTCATGCTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-1053s1c1
Sequence:CCGGGCGAGAACTTTCTCTATGAAACTCGAGTTTCATAGAGAAAGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-3157s1c1
Sequence:CCGGCCGCCACTTCTATAACCAGAACTCGAGTTCTGGTTATAGAAGTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031178
TLR9 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031178.2-485s21c1
Sequence:CCGGGAGCTGAACTTGAGCTATAATCTCGAGATTATAGCTCAAGTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031178.2-3292s21c1
Sequence:CCGGATTTGGCAAGTGCGCAATATACTCGAGTATATTGCGCACTTGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031178.2-1655s21c1
Sequence:CCGGCAGTTCCTGCCGCTGACTAATCTCGAGATTAGTCAGCGGCAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031178.2-776s21c1
Sequence:CCGGTACCTCCTGGTGTCCTATAACCTCGAGGTTATAGGACACCAGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031178.1-3274s1c1
Sequence:CCGGCTGTCTTACTACACCGCTATTCTCGAGAATAGCGGTGTAGTAAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-1171s1c1
Sequence:CCGGCCTGGCAAGTTCCTTCAAGAACTCGAGTTCTTGAAGGAACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-1780s1c1
Sequence:CCGGGCCCTTTAGCATGAAGGGTATCTCGAGATACCCTTCATGCTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-1053s1c1
Sequence:CCGGGCGAGAACTTTCTCTATGAAACTCGAGTTTCATAGAGAAAGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-3157s1c1
Sequence:CCGGCCGCCACTTCTATAACCAGAACTCGAGTTCTGGTTATAGAAGTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031178
TLR9 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031178.2-485s21c1
Sequence:CCGGGAGCTGAACTTGAGCTATAATCTCGAGATTATAGCTCAAGTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031178.2-3292s21c1
Sequence:CCGGATTTGGCAAGTGCGCAATATACTCGAGTATATTGCGCACTTGCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031178.2-1655s21c1
Sequence:CCGGCAGTTCCTGCCGCTGACTAATCTCGAGATTAGTCAGCGGCAGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031178.2-776s21c1
Sequence:CCGGTACCTCCTGGTGTCCTATAACCTCGAGGTTATAGGACACCAGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031178.1-3274s1c1
Sequence:CCGGCTGTCTTACTACACCGCTATTCTCGAGAATAGCGGTGTAGTAAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-1171s1c1
Sequence:CCGGCCTGGCAAGTTCCTTCAAGAACTCGAGTTCTTGAAGGAACTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-1780s1c1
Sequence:CCGGGCCCTTTAGCATGAAGGGTATCTCGAGATACCCTTCATGCTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-1053s1c1
Sequence:CCGGGCGAGAACTTTCTCTATGAAACTCGAGTTTCATAGAGAAAGTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031178.1-3157s1c1
Sequence:CCGGCCGCCACTTCTATAACCAGAACTCGAGTTCTGGTTATAGAAGTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017442
TLR9 MISSION shRNA Bacterial Glycerol Stock
toll-like receptor 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017442.2-1317s21c1
Sequence:CCGGCCTACAACCGCATCGTCAAACCTCGAGGTTTGACGATGCGGTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017442.2-1153s21c1
Sequence:CCGGCATGGACGGCAACTGTTATTACTCGAGTAATAACAGTTGCCGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-1159s1c1
Sequence:CCGGCGGCAACTGTTATTACAAGAACTCGAGTTCTTGTAATAACAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-3688s1c1
Sequence:CCGGCCACTTCTATAACCGGAACTTCTCGAGAAGTTCCGGTTATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-1021s1c1
Sequence:CCGGCCTGAGCTACAACAACATCATCTCGAGATGATGTTGTTGTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-2885s1c1
Sequence:CCGGGCCCTGCAAATACTAGATGTACTCGAGTACATCTAGTATTTGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-2209s1c1
Sequence:CCGGGCTAGACCTGTCCCACAATAACTCGAGTTATTGTGGGACAGGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017442
TLR9 MISSION shRNA shRNA Plasmid DNA
toll-like receptor 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017442.2-1317s21c1
Sequence:CCGGCCTACAACCGCATCGTCAAACCTCGAGGTTTGACGATGCGGTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017442.2-1153s21c1
Sequence:CCGGCATGGACGGCAACTGTTATTACTCGAGTAATAACAGTTGCCGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-1159s1c1
Sequence:CCGGCGGCAACTGTTATTACAAGAACTCGAGTTCTTGTAATAACAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-3688s1c1
Sequence:CCGGCCACTTCTATAACCGGAACTTCTCGAGAAGTTCCGGTTATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-1021s1c1
Sequence:CCGGCCTGAGCTACAACAACATCATCTCGAGATGATGTTGTTGTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-2885s1c1
Sequence:CCGGGCCCTGCAAATACTAGATGTACTCGAGTACATCTAGTATTTGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-2209s1c1
Sequence:CCGGGCTAGACCTGTCCCACAATAACTCGAGTTATTGTGGGACAGGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017442
TLR9 MISSION shRNA Lentiviral Transduction Particles
toll-like receptor 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017442.2-1317s21c1
Sequence:CCGGCCTACAACCGCATCGTCAAACCTCGAGGTTTGACGATGCGGTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017442.2-1153s21c1
Sequence:CCGGCATGGACGGCAACTGTTATTACTCGAGTAATAACAGTTGCCGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-1159s1c1
Sequence:CCGGCGGCAACTGTTATTACAAGAACTCGAGTTCTTGTAATAACAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-3688s1c1
Sequence:CCGGCCACTTCTATAACCGGAACTTCTCGAGAAGTTCCGGTTATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-1021s1c1
Sequence:CCGGCCTGAGCTACAACAACATCATCTCGAGATGATGTTGTTGTAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-2885s1c1
Sequence:CCGGGCCCTGCAAATACTAGATGTACTCGAGTACATCTAGTATTTGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017442.2-2209s1c1
Sequence:CCGGGCTAGACCTGTCCCACAATAACTCGAGTTATTGTGGGACAGGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks