EMAIL THIS PAGE TO A FRIEND

TLX1

T-cell leukemia homeobox 1

Synonyms: HOX11 TCL3
UniProtKB ID: P31314, A1L4G3, O75699, Q5VXP2, Q9HCA0, Q9UD59
Gene ID:
Human(3195) Summary: This gene encodes a nuclear transcription factor that belongs to the NK-linked or NK-like (NKL) subfamily of homeobox genes. The encoded protein is required for normal development of the spleen during embryogenesis. This protein is also involved in specification of neuronal cell fates. Ectopic expression of this gene due to chromosomal translocations is associated with certain T-cell acute lymphoblastic leukemias. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
Mouse(21908) T cell leukemia, homeobox 1
Rat(499361) T-cell leukemia, homeobox 1
cow(505304) T-cell leukemia homeobox 1
sheep(101112937) T-cell leukemia homeobox 1
domestic guinea pig(100730661) T-cell leukemia homeobox 1
naked mole-rat(101725642) T-cell leukemia homeobox 1
Zebrafish(266964) T-cell leukemia, homeobox 1
chicken(395868) T-cell leukemia homeobox 1
domestic cat(101096848) T-cell leukemia homeobox 1
dog(608311) T-cell leukemia homeobox 1
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100886 Anti-TLX1 (176-188) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2102441 Anti-TLX1 (ab1) antibody produced in rabbit affinity isolated antibody canine, bovine, guinea pig, rat, human, mouse, rabbit, zebrafish
western blot pricing
SAB2102442 Anti-TLX1 (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, zebrafish, rabbit, human, bovine, mouse, rat, canine
western blot pricing
SAB2104664 Anti-TLX1, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rabbit, canine, guinea pig, rat, bovine, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021901 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021901 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021901 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005521 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032941 MISSION® esiRNA esiRNA targeting mouse Tlx1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005521 Rosetta Predictions human pricing
NM_001109166 Rosetta Predictions rat pricing
NM_021901 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156791 predicted 1896
2 SASI_Hs01_00156792 predicted 1806
3 SASI_Hs01_00156793 predicted 1944
4 SASI_Hs01_00156794 predicted 1885
5 SASI_Hs01_00156796 predicted 1944
6 SASI_Hs01_00156797 predicted 1828
7 SASI_Hs01_00156798 predicted 1833
8 SASI_Hs01_00156799 predicted 1997
9 SASI_Hs01_00156800 predicted 1894
10 SASI_Hs02_00339738 predicted 1818
11 SASI_Hs01_00156795 predicted 1893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245780 predicted 738
2 SASI_Rn02_00245781 predicted 1235
3 SASI_Rn02_00245782 predicted 1631
4 SASI_Rn02_00245783 predicted 1617
5 SASI_Rn02_00245784 predicted 1140
6 SASI_Rn02_00245785 predicted 738
7 SASI_Rn02_00245786 predicted 970
8 SASI_Rn02_00245787 predicted 1628
9 SASI_Rn02_00245788 predicted 1513
10 SASI_Rn02_00245789 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199361 predicted 1140
2 SASI_Mm01_00199362 predicted 1403
3 SASI_Mm01_00199363 predicted 1210
4 SASI_Mm01_00199364 predicted 1383
5 SASI_Mm01_00199365 predicted 1242
6 SASI_Mm01_00199366 predicted 1680
7 SASI_Mm01_00199367 predicted 1682
8 SASI_Mm01_00199368 predicted 1246
9 SASI_Mm01_00199369 predicted 1642
10 SASI_Mm01_00199370 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021901
TLX1 MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia homeobox 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-738s1c1
Sequence:CCGGGATGGAGAGTAACCGCAGATACTCGAGTATCTGCGGTTACTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-258s1c1
Sequence:CCGGCGGTATCGACCAGATCCTCAACTCGAGTTGAGGATCTGGTCGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-822s1c1
Sequence:CCGGGCGCACATCCTTCACGCGCCTCTCGAGAGGCGCGTGAAGGATGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-1169s1c1
Sequence:CCGGCCAGCGTCACGTCCGTGGCTTCTCGAGAAGCCACGGACGTGACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-966s1c1
Sequence:CCGGGAGGACGAAATGGAGGCGACACTCGAGTGTCGCCTCCATTTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021901
TLX1 MISSION shRNA shRNA Plasmid DNA
T-cell leukemia homeobox 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-738s1c1
Sequence:CCGGGATGGAGAGTAACCGCAGATACTCGAGTATCTGCGGTTACTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-258s1c1
Sequence:CCGGCGGTATCGACCAGATCCTCAACTCGAGTTGAGGATCTGGTCGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-822s1c1
Sequence:CCGGGCGCACATCCTTCACGCGCCTCTCGAGAGGCGCGTGAAGGATGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-1169s1c1
Sequence:CCGGCCAGCGTCACGTCCGTGGCTTCTCGAGAAGCCACGGACGTGACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-966s1c1
Sequence:CCGGGAGGACGAAATGGAGGCGACACTCGAGTGTCGCCTCCATTTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021901
TLX1 MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia homeobox 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-738s1c1
Sequence:CCGGGATGGAGAGTAACCGCAGATACTCGAGTATCTGCGGTTACTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-258s1c1
Sequence:CCGGCGGTATCGACCAGATCCTCAACTCGAGTTGAGGATCTGGTCGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-822s1c1
Sequence:CCGGGCGCACATCCTTCACGCGCCTCTCGAGAGGCGCGTGAAGGATGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-1169s1c1
Sequence:CCGGCCAGCGTCACGTCCGTGGCTTCTCGAGAAGCCACGGACGTGACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021901.2-966s1c1
Sequence:CCGGGAGGACGAAATGGAGGCGACACTCGAGTGTCGCCTCCATTTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005521
TLX1 MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia homeobox 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005521.2-2230s1c1
Sequence:CCGGCGCACCTGTCTGAACTGTTAACTCGAGTTAACAGTTCAGACAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1560s1c1
Sequence:CCGGGCAGATACACAAAGGACAGGTCTCGAGACCTGTCCTTTGTGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1318s1c1
Sequence:CCGGCTACAACGTGAACATGGCCTTCTCGAGAAGGCCATGTTCACGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1139s1c1
Sequence:CCGGCAGGACGGAGAATACGGCCTTCTCGAGAAGGCCGTATTCTCCGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1312s1c1
Sequence:CCGGCGGCTCCTACAACGTGAACATCTCGAGATGTTCACGTTGTAGGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005521.3-1453s21c1
Sequence:CCGGGCACCTGTCTGAACTGTTAAGCTCGAGCTTAACAGTTCAGACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005521.3-274s21c1
Sequence:CCGGTCACGCAGAGCCCATTAGCTTCTCGAGAAGCTAATGGGCTCTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005521.3-1692s21c1
Sequence:CCGGAGCCACACATGGGCATCTATGCTCGAGCATAGATGCCCATGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005521.3-767s21c1
Sequence:CCGGATGGAGAGTAACCGCAGATACCTCGAGGTATCTGCGGTTACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005521
TLX1 MISSION shRNA shRNA Plasmid DNA
T-cell leukemia homeobox 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005521.2-2230s1c1
Sequence:CCGGCGCACCTGTCTGAACTGTTAACTCGAGTTAACAGTTCAGACAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1560s1c1
Sequence:CCGGGCAGATACACAAAGGACAGGTCTCGAGACCTGTCCTTTGTGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1318s1c1
Sequence:CCGGCTACAACGTGAACATGGCCTTCTCGAGAAGGCCATGTTCACGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1139s1c1
Sequence:CCGGCAGGACGGAGAATACGGCCTTCTCGAGAAGGCCGTATTCTCCGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1312s1c1
Sequence:CCGGCGGCTCCTACAACGTGAACATCTCGAGATGTTCACGTTGTAGGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005521.3-1453s21c1
Sequence:CCGGGCACCTGTCTGAACTGTTAAGCTCGAGCTTAACAGTTCAGACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005521.3-274s21c1
Sequence:CCGGTCACGCAGAGCCCATTAGCTTCTCGAGAAGCTAATGGGCTCTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005521.3-1692s21c1
Sequence:CCGGAGCCACACATGGGCATCTATGCTCGAGCATAGATGCCCATGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005521.3-767s21c1
Sequence:CCGGATGGAGAGTAACCGCAGATACCTCGAGGTATCTGCGGTTACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005521
TLX1 MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia homeobox 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005521.2-2230s1c1
Sequence:CCGGCGCACCTGTCTGAACTGTTAACTCGAGTTAACAGTTCAGACAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1560s1c1
Sequence:CCGGGCAGATACACAAAGGACAGGTCTCGAGACCTGTCCTTTGTGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1318s1c1
Sequence:CCGGCTACAACGTGAACATGGCCTTCTCGAGAAGGCCATGTTCACGTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1139s1c1
Sequence:CCGGCAGGACGGAGAATACGGCCTTCTCGAGAAGGCCGTATTCTCCGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005521.2-1312s1c1
Sequence:CCGGCGGCTCCTACAACGTGAACATCTCGAGATGTTCACGTTGTAGGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005521.3-1453s21c1
Sequence:CCGGGCACCTGTCTGAACTGTTAAGCTCGAGCTTAACAGTTCAGACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005521.3-274s21c1
Sequence:CCGGTCACGCAGAGCCCATTAGCTTCTCGAGAAGCTAATGGGCTCTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005521.3-1692s21c1
Sequence:CCGGAGCCACACATGGGCATCTATGCTCGAGCATAGATGCCCATGTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005521.3-767s21c1
Sequence:CCGGATGGAGAGTAACCGCAGATACCTCGAGGTATCTGCGGTTACTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks