EMAIL THIS PAGE TO A FRIEND

TLX1NB

TLX1 neighbor

Synonyms: APT-B7 TD1 TDI
Species: Human TLX1NB(100038246)
UniProtKB ID: P0CAT3
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085398 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085398 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317585 predicted 1352
2 SASI_Hs02_00317586 predicted 1346
3 SASI_Hs02_00317587 predicted 1478
4 SASI_Hs02_00317588 predicted 1346
5 SASI_Hs02_00317589 predicted 1350
6 SASI_Hs02_00317590 predicted 1340
7 SASI_Hs02_00317591 predicted 1407
8 SASI_Hs02_00317592 predicted 1583
9 SASI_Hs02_00317593 predicted 1569
10 SASI_Hs02_00317594 predicted 1543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085398
TLX1NB MISSION shRNA Bacterial Glycerol Stock
TLX1 neighbor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1486s21c1
Sequence:CCGGGTGTTCTCTGACACCAGGTTCCTCGAGGAACCTGGTGTCAGAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1581s21c1
Sequence:CCGGGGTCACCTCAGCTGGAGAAATCTCGAGATTTCTCCAGCTGAGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1546s21c1
Sequence:CCGGCCACCCTTCTCAAACCCAGAACTCGAGTTCTGGGTTTGAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1604s21c1
Sequence:CCGGAGAATCCGCCTACGGAGAACACTCGAGTGTTCTCCGTAGGCGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085398.1-1683s21c1
Sequence:CCGGGGGAAAGTTAGCCTATGCTGACTCGAGTCAGCATAGGCTAACTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085398
TLX1NB MISSION shRNA shRNA Plasmid DNA
TLX1 neighbor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1486s21c1
Sequence:CCGGGTGTTCTCTGACACCAGGTTCCTCGAGGAACCTGGTGTCAGAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1581s21c1
Sequence:CCGGGGTCACCTCAGCTGGAGAAATCTCGAGATTTCTCCAGCTGAGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1546s21c1
Sequence:CCGGCCACCCTTCTCAAACCCAGAACTCGAGTTCTGGGTTTGAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1604s21c1
Sequence:CCGGAGAATCCGCCTACGGAGAACACTCGAGTGTTCTCCGTAGGCGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085398.1-1683s21c1
Sequence:CCGGGGGAAAGTTAGCCTATGCTGACTCGAGTCAGCATAGGCTAACTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085398
TLX1NB MISSION shRNA Lentiviral Transduction Particles
TLX1 neighbor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1486s21c1
Sequence:CCGGGTGTTCTCTGACACCAGGTTCCTCGAGGAACCTGGTGTCAGAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1581s21c1
Sequence:CCGGGGTCACCTCAGCTGGAGAAATCTCGAGATTTCTCCAGCTGAGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1546s21c1
Sequence:CCGGCCACCCTTCTCAAACCCAGAACTCGAGTTCTGGGTTTGAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085398.1-1604s21c1
Sequence:CCGGAGAATCCGCCTACGGAGAACACTCGAGTGTTCTCCGTAGGCGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085398.1-1683s21c1
Sequence:CCGGGGGAAAGTTAGCCTATGCTGACTCGAGTCAGCATAGGCTAACTTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks