EMAIL THIS PAGE TO A FRIEND

TLX2

T-cell leukemia homeobox 2

Synonyms: HOX11L1 NCX
UniProtKB ID: O43763, Q9UD56, Q9UQ48
Gene ID:
Human(3196) Summary: This gene is a member of an orphan homeobox-containing transcription factor family. Studies of the mouse ortholog have shown that the encoded protein is crucial for the development of the enteric nervous system; in humans, loss-of-function may play a role in tumorigenesis of gastrointestinal stromal tumors. [provided by RefSeq, May 2010]
Mouse(21909) T cell leukemia, homeobox 2
Rat(680117) T-cell leukemia homeobox 2
Zebrafish(170781) T-cell leukemia, homeobox 2
domestic cat(101101127) T-cell leukemia homeobox 2
dog(483102) T-cell leukemia homeobox 2
chicken(101669132) T-cell leukemia homeobox 2
chicken(101747242) T-cell leukemia homeobox 2
naked mole-rat(101696589) T-cell leukemia homeobox 2
domestic guinea pig(100734899) T-cell leukemia homeobox 2
cow(539041) T-cell leukemia homeobox 2
sheep(101119197) T-cell leukemia homeobox 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001534 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154061 MISSION® esiRNA esiRNA targeting mouse Tlx2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016170 Rosetta Predictions human pricing
XM_001054552 Rosetta Predictions rat pricing
XM_001054603 Rosetta Predictions rat pricing
NM_009392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082366 predicted 1337
2 SASI_Hs01_00082368 predicted 1488
3 SASI_Hs01_00082369 predicted 325
4 SASI_Hs02_00348984 predicted 811
5 SASI_Hs01_00082370 predicted 341
6 SASI_Hs01_00082371 predicted 1260
7 SASI_Hs01_00082372 predicted 1072
8 SASI_Hs01_00082373 predicted 1495
9 SASI_Hs01_00082374 predicted 461
10 SASI_Hs01_00082375 predicted 1483
11 SASI_Hs01_00082367 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276243 predicted 945
2 SASI_Rn02_00276244 predicted 340
3 SASI_Rn02_00276245 predicted 696
4 SASI_Rn02_00276246 predicted 325
5 SASI_Rn02_00276247 predicted 700
6 SASI_Rn02_00276248 predicted 699
7 SASI_Rn02_00276249 predicted 236
8 SASI_Rn02_00276250 predicted 944
9 SASI_Rn02_00276251 predicted 255
10 SASI_Rn02_00276252 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276430 predicted 980
2 SASI_Rn02_00276431 predicted 343
3 SASI_Rn02_00276432 predicted 731
4 SASI_Rn02_00276433 predicted 325
5 SASI_Rn02_00276434 predicted 736
6 SASI_Rn02_00276435 predicted 737
7 SASI_Rn02_00276436 predicted 234
8 SASI_Rn02_00276437 predicted 981
9 SASI_Rn02_00276438 predicted 255
10 SASI_Rn02_00276439 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197644 predicted 662
2 SASI_Mm01_00197645 predicted 518
3 SASI_Mm01_00197646 predicted 508
4 SASI_Mm01_00197647 predicted 446
5 SASI_Mm01_00197648 predicted 549
6 SASI_Mm01_00197649 predicted 888
7 SASI_Mm01_00197650 predicted 538
8 SASI_Mm01_00197651 predicted 256
9 SASI_Mm01_00197652 predicted 333
10 SASI_Mm01_00197653 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009392
TLX2 MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009392.2-1133s21c1
Sequence:CCGGTGACTCCGCCCTTCAAGGTTTCTCGAGAAACCTTGAAGGGCGGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009392.2-958s21c1
Sequence:CCGGACAACAAGGTGGCTTCGGTGTCTCGAGACACCGAAGCCACCTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009392.2-1093s21c1
Sequence:CCGGCTGAGGCTCTTTGGTCATCAGCTCGAGCTGATGACCAAAGAGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-100s1c1
Sequence:CCGGGCACCACGAACCCATCAGCTTCTCGAGAAGCTGATGGGTTCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-810s1c1
Sequence:CCGGCGGACCCGCTTTGCCTGCACACTCGAGTGTGCAGGCAAAGCGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-490s1c1
Sequence:CCGGACGTCGCATAGGCCATCCCTACTCGAGTAGGGATGGCCTATGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-193s1c1
Sequence:CCGGCCACGGAGAAAGTGCGGCGTTCTCGAGAACGCCGCACTTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-364s1c1
Sequence:CCGGCGTGCCCGGACCCTCTGGTTTCTCGAGAAACCAGAGGGTCCGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009392
TLX2 MISSION shRNA shRNA Plasmid DNA
T-cell leukemia homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009392.2-1133s21c1
Sequence:CCGGTGACTCCGCCCTTCAAGGTTTCTCGAGAAACCTTGAAGGGCGGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009392.2-958s21c1
Sequence:CCGGACAACAAGGTGGCTTCGGTGTCTCGAGACACCGAAGCCACCTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009392.2-1093s21c1
Sequence:CCGGCTGAGGCTCTTTGGTCATCAGCTCGAGCTGATGACCAAAGAGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-100s1c1
Sequence:CCGGGCACCACGAACCCATCAGCTTCTCGAGAAGCTGATGGGTTCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-810s1c1
Sequence:CCGGCGGACCCGCTTTGCCTGCACACTCGAGTGTGCAGGCAAAGCGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-490s1c1
Sequence:CCGGACGTCGCATAGGCCATCCCTACTCGAGTAGGGATGGCCTATGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-193s1c1
Sequence:CCGGCCACGGAGAAAGTGCGGCGTTCTCGAGAACGCCGCACTTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-364s1c1
Sequence:CCGGCGTGCCCGGACCCTCTGGTTTCTCGAGAAACCAGAGGGTCCGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009392
TLX2 MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009392.2-1133s21c1
Sequence:CCGGTGACTCCGCCCTTCAAGGTTTCTCGAGAAACCTTGAAGGGCGGAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009392.2-958s21c1
Sequence:CCGGACAACAAGGTGGCTTCGGTGTCTCGAGACACCGAAGCCACCTTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009392.2-1093s21c1
Sequence:CCGGCTGAGGCTCTTTGGTCATCAGCTCGAGCTGATGACCAAAGAGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-100s1c1
Sequence:CCGGGCACCACGAACCCATCAGCTTCTCGAGAAGCTGATGGGTTCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-810s1c1
Sequence:CCGGCGGACCCGCTTTGCCTGCACACTCGAGTGTGCAGGCAAAGCGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-490s1c1
Sequence:CCGGACGTCGCATAGGCCATCCCTACTCGAGTAGGGATGGCCTATGCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-193s1c1
Sequence:CCGGCCACGGAGAAAGTGCGGCGTTCTCGAGAACGCCGCACTTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009392.1-364s1c1
Sequence:CCGGCGTGCCCGGACCCTCTGGTTTCTCGAGAAACCAGAGGGTCCGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001534
VALIDATED
TLX2 MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-740s1c1
Sequence:CCGGCCGAGGACAACAAAGTGGCTTCTCGAGAAGCCACTTTGTTGTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-753s1c1
Sequence:CCGGAGTGGCTTCAGTGTCCGGGCTCTCGAGAGCCCGGACACTGAAGCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-733s1c1
Sequence:CCGGCCCTGGGCCGAGGACAACAAACTCGAGTTTGTTGTCCTCGGCCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-618s1c1
Sequence:CCGGCCGGCTGCTCCTGCATCTGCACTCGAGTGCAGATGCAGGAGCAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-716s1c1
Sequence:CCGGCGCTGCAGAACCTGCAGCCCTCTCGAGAGGGCTGCAGGTTCTGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001534
VALIDATED
TLX2 MISSION shRNA shRNA Plasmid DNA
T-cell leukemia homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-740s1c1
Sequence:CCGGCCGAGGACAACAAAGTGGCTTCTCGAGAAGCCACTTTGTTGTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-753s1c1
Sequence:CCGGAGTGGCTTCAGTGTCCGGGCTCTCGAGAGCCCGGACACTGAAGCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-733s1c1
Sequence:CCGGCCCTGGGCCGAGGACAACAAACTCGAGTTTGTTGTCCTCGGCCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-618s1c1
Sequence:CCGGCCGGCTGCTCCTGCATCTGCACTCGAGTGCAGATGCAGGAGCAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-716s1c1
Sequence:CCGGCGCTGCAGAACCTGCAGCCCTCTCGAGAGGGCTGCAGGTTCTGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001534
VALIDATED
TLX2 MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-740s1c1
Sequence:CCGGCCGAGGACAACAAAGTGGCTTCTCGAGAAGCCACTTTGTTGTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-753s1c1
Sequence:CCGGAGTGGCTTCAGTGTCCGGGCTCTCGAGAGCCCGGACACTGAAGCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-733s1c1
Sequence:CCGGCCCTGGGCCGAGGACAACAAACTCGAGTTTGTTGTCCTCGGCCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-618s1c1
Sequence:CCGGCCGGCTGCTCCTGCATCTGCACTCGAGTGCAGATGCAGGAGCAGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001534.2-716s1c1
Sequence:CCGGCGCTGCAGAACCTGCAGCCCTCTCGAGAGGGCTGCAGGTTCTGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks