EMAIL THIS PAGE TO A FRIEND

TLX3

T-cell leukemia homeobox 3

Synonyms: HOX11L2 RNX
UniProtKB ID: O43711, Q96AD3
Gene ID:
Human(30012) Summary: RNX (HOX11L2, TLX3) belongs to a family of orphan homeobox genes that encode DNA-binding nuclear transcription factors. Members of the HOX11 gene family are characterized by a threonine-47 replacing cytosine in the highly conserved homeodomain (Dear et al., 1993 [PubMed 8099440]
Mouse(27140) T cell leukemia, homeobox 3
Rat(497881) T-cell leukemia, homeobox 3
cow(618473) T-cell leukemia homeobox 3
sheep(101106882) T-cell leukemia homeobox 3
cow(789584) T-cell leukemia homeobox 3
domestic guinea pig(100724310) T-cell leukemia homeobox 3
naked mole-rat(101702946) T-cell leukemia homeobox 3
chicken(395867) T-cell leukemia homeobox 3
domestic cat(101098771) T-cell leukemia homeobox 3
dog(489123) T-cell leukemia homeobox 3
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021025 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021025 Rosetta Predictions human pricing
XM_001064411 Rosetta Predictions rat pricing
XM_573065 Rosetta Predictions rat pricing
NM_019916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105285 predicted 873
2 SASI_Hs01_00105286 predicted 793
3 SASI_Hs01_00105287 predicted 934
4 SASI_Hs01_00105288 predicted 799
5 SASI_Hs01_00105289 predicted 504
6 SASI_Hs01_00105291 predicted 794
7 SASI_Hs01_00105292 predicted 280
8 SASI_Hs01_00105293 predicted 732
9 SASI_Hs01_00105290 predicted 295
10 SASI_Hs01_00105294 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310384 predicted 618
2 SASI_Rn02_00310385 predicted 356
3 SASI_Rn02_00310386 predicted 908
4 SASI_Rn02_00310387 predicted 525
5 SASI_Rn02_00310388 predicted 567
6 SASI_Rn02_00310389 predicted 491
7 SASI_Rn02_00310390 predicted 726
8 SASI_Rn02_00310391 predicted 521
9 SASI_Rn02_00310392 predicted 733
10 SASI_Rn02_00310393 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399726 predicted 620
2 SASI_Rn02_00399727 predicted 347
3 SASI_Rn02_00399728 predicted 909
4 SASI_Rn02_00399729 predicted 523
5 SASI_Rn02_00399730 predicted 567
6 SASI_Rn02_00399731 predicted 489
7 SASI_Rn02_00399732 predicted 727
8 SASI_Rn02_00399733 predicted 527
9 SASI_Rn02_00399734 predicted 727
10 SASI_Rn02_00399735 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028632 predicted 424
2 SASI_Mm01_00028633 predicted 587
3 SASI_Mm01_00028634 predicted 473
4 SASI_Mm01_00028635 predicted 215
5 SASI_Mm02_00325193 predicted 222
6 SASI_Mm01_00028636 predicted 425
7 SASI_Mm01_00028638 predicted 216
8 SASI_Mm01_00028639 predicted 494
9 SASI_Mm01_00028640 predicted 651
10 SASI_Mm01_00028641 predicted 578
11 SASI_Mm01_00028637 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019916
TLX3 MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia homeobox 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-592s1c1
Sequence:CCGGGCGCTCGCAAAGTCCCTCAAACTCGAGTTTGAGGGACTTTGCGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-33s1c1
Sequence:CCGGCCCGCACGAGCCCATCAGCTTCTCGAGAAGCTGATGGGCTCGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-711s1c1
Sequence:CCGGCCGGCTCATGCTACAGCTGCACTCGAGTGCAGCTGTAGCATGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-398s1c1
Sequence:CCGGGCTTTGTAAAGGACCGCTTCACTCGAGTGAAGCGGTCCTTTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-480s1c1
Sequence:CCGGCCGGACGCCACCCAAGCGTAACTCGAGTTACGCTTGGGTGGCGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019916.2-350s21c1
Sequence:CCGGGATCTTACAGTGTCAACCTAACTCGAGTTAGGTTGACACTGTAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019916.2-1237s21c1
Sequence:CCGGCCTGACAAAGAAGCGCCTTACCTCGAGGTAAGGCGCTTCTTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019916
TLX3 MISSION shRNA shRNA Plasmid DNA
T-cell leukemia homeobox 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-592s1c1
Sequence:CCGGGCGCTCGCAAAGTCCCTCAAACTCGAGTTTGAGGGACTTTGCGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-33s1c1
Sequence:CCGGCCCGCACGAGCCCATCAGCTTCTCGAGAAGCTGATGGGCTCGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-711s1c1
Sequence:CCGGCCGGCTCATGCTACAGCTGCACTCGAGTGCAGCTGTAGCATGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-398s1c1
Sequence:CCGGGCTTTGTAAAGGACCGCTTCACTCGAGTGAAGCGGTCCTTTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-480s1c1
Sequence:CCGGCCGGACGCCACCCAAGCGTAACTCGAGTTACGCTTGGGTGGCGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019916.2-350s21c1
Sequence:CCGGGATCTTACAGTGTCAACCTAACTCGAGTTAGGTTGACACTGTAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019916.2-1237s21c1
Sequence:CCGGCCTGACAAAGAAGCGCCTTACCTCGAGGTAAGGCGCTTCTTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019916
TLX3 MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia homeobox 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-592s1c1
Sequence:CCGGGCGCTCGCAAAGTCCCTCAAACTCGAGTTTGAGGGACTTTGCGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-33s1c1
Sequence:CCGGCCCGCACGAGCCCATCAGCTTCTCGAGAAGCTGATGGGCTCGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-711s1c1
Sequence:CCGGCCGGCTCATGCTACAGCTGCACTCGAGTGCAGCTGTAGCATGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-398s1c1
Sequence:CCGGGCTTTGTAAAGGACCGCTTCACTCGAGTGAAGCGGTCCTTTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019916.1-480s1c1
Sequence:CCGGCCGGACGCCACCCAAGCGTAACTCGAGTTACGCTTGGGTGGCGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019916.2-350s21c1
Sequence:CCGGGATCTTACAGTGTCAACCTAACTCGAGTTAGGTTGACACTGTAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019916.2-1237s21c1
Sequence:CCGGCCTGACAAAGAAGCGCCTTACCTCGAGGTAAGGCGCTTCTTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021025
TLX3 MISSION shRNA Bacterial Glycerol Stock
T-cell leukemia homeobox 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-216s1c1
Sequence:CCGGCGCGGGATCTTACAGTGTCAACTCGAGTTGACACTGTAAGATCCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-592s1c1
Sequence:CCGGGCGCTCGCCAAGTCCCTCAAACTCGAGTTTGAGGGACTTGGCGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-712s1c1
Sequence:CCGGCGGCTCATGCTGCAGCTGCAACTCGAGTTGCAGCTGCAGCATGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-723s1c1
Sequence:CCGGGCAGCTGCAACACGACGCCTTCTCGAGAAGGCGTCGTGTTGCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-398s1c1
Sequence:CCGGGCTTTGTGAAAGACCGCTTCACTCGAGTGAAGCGGTCTTTCACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021025.2-1194s21c1
Sequence:CCGGCCTGACAAGAAAGCGCCTTACCTCGAGGTAAGGCGCTTTCTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021025.2-480s21c1
Sequence:CCGGGCTTCGTGAAAGACCGCTTCACTCGAGTGAAGCGGTCTTTCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021025.2-870s21c1
Sequence:CCGGTGCACAACTCGTCACTCTTTGCTCGAGCAAAGAGTGACGAGTTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021025.2-437s21c1
Sequence:CCGGAGCCTTGGCGGTCTCAATTTCCTCGAGGAAATTGAGACCGCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021025
TLX3 MISSION shRNA shRNA Plasmid DNA
T-cell leukemia homeobox 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-216s1c1
Sequence:CCGGCGCGGGATCTTACAGTGTCAACTCGAGTTGACACTGTAAGATCCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-592s1c1
Sequence:CCGGGCGCTCGCCAAGTCCCTCAAACTCGAGTTTGAGGGACTTGGCGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-712s1c1
Sequence:CCGGCGGCTCATGCTGCAGCTGCAACTCGAGTTGCAGCTGCAGCATGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-723s1c1
Sequence:CCGGGCAGCTGCAACACGACGCCTTCTCGAGAAGGCGTCGTGTTGCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-398s1c1
Sequence:CCGGGCTTTGTGAAAGACCGCTTCACTCGAGTGAAGCGGTCTTTCACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021025.2-1194s21c1
Sequence:CCGGCCTGACAAGAAAGCGCCTTACCTCGAGGTAAGGCGCTTTCTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021025.2-480s21c1
Sequence:CCGGGCTTCGTGAAAGACCGCTTCACTCGAGTGAAGCGGTCTTTCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021025.2-870s21c1
Sequence:CCGGTGCACAACTCGTCACTCTTTGCTCGAGCAAAGAGTGACGAGTTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021025.2-437s21c1
Sequence:CCGGAGCCTTGGCGGTCTCAATTTCCTCGAGGAAATTGAGACCGCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021025
TLX3 MISSION shRNA Lentiviral Transduction Particles
T-cell leukemia homeobox 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-216s1c1
Sequence:CCGGCGCGGGATCTTACAGTGTCAACTCGAGTTGACACTGTAAGATCCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-592s1c1
Sequence:CCGGGCGCTCGCCAAGTCCCTCAAACTCGAGTTTGAGGGACTTGGCGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-712s1c1
Sequence:CCGGCGGCTCATGCTGCAGCTGCAACTCGAGTTGCAGCTGCAGCATGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-723s1c1
Sequence:CCGGGCAGCTGCAACACGACGCCTTCTCGAGAAGGCGTCGTGTTGCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021025.1-398s1c1
Sequence:CCGGGCTTTGTGAAAGACCGCTTCACTCGAGTGAAGCGGTCTTTCACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021025.2-1194s21c1
Sequence:CCGGCCTGACAAGAAAGCGCCTTACCTCGAGGTAAGGCGCTTTCTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021025.2-480s21c1
Sequence:CCGGGCTTCGTGAAAGACCGCTTCACTCGAGTGAAGCGGTCTTTCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021025.2-870s21c1
Sequence:CCGGTGCACAACTCGTCACTCTTTGCTCGAGCAAAGAGTGACGAGTTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021025.2-437s21c1
Sequence:CCGGAGCCTTGGCGGTCTCAATTTCCTCGAGGAAATTGAGACCGCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks