EMAIL THIS PAGE TO A FRIEND

TM2D1

TM2 domain containing 1

Synonyms: BBP
UniProtKB ID: Q9BX74, A6NDA8
Gene ID:
Human(83941) Summary: The protein encoded by this gene is a beta-amyloid peptide-binding protein. It contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily and known to be important in heterotrimeric G protein activation. Beta-amyloid peptide has been established to be a causative factor in neuron death and the consequent diminution of cognitive abilities observed in Alzheimer's disease. This protein may be a target of neurotoxic beta-amyloid peptide, and may mediate cellular vulnerability to beta-amyloid peptide toxicity through a G protein-regulated program of cell death. [provided by RefSeq, Dec 2008]
Mouse(94043) TM2 domain containing 1
Rat(362545) TM2 domain containing 1
Zebrafish(100093710) TM2 domain containing 1
domestic cat(101080393) TM2 domain containing 1
dog(479551) TM2 domain containing 1
chicken(775978) TM2 domain containing 1
cow(514249) TM2 domain containing 1
naked mole-rat(101721201) TM2 domain containing 1
domestic guinea pig(100722312) TM2 domain containing 1
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018021 MISSION® esiRNA esiRNA targeting human TM2D1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032027 Rosetta Predictions human pricing
NM_001108670 Rosetta Predictions rat pricing
NM_053157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203816 predicted 879
2 SASI_Hs01_00203817 predicted 824
3 SASI_Hs02_00359217 predicted 828
4 SASI_Hs01_00203818 predicted 497
5 SASI_Hs01_00203819 predicted 452
6 SASI_Hs01_00203820 predicted 772
7 SASI_Hs01_00203821 predicted 502
8 SASI_Hs01_00203822 predicted 499
9 SASI_Hs01_00203823 predicted 573
10 SASI_Hs01_00203824 predicted 819
11 SASI_Hs01_00203825 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240915 predicted 909
2 SASI_Rn02_00240916 predicted 904
3 SASI_Rn02_00240917 predicted 1037
4 SASI_Rn02_00240918 predicted 851
5 SASI_Rn02_00240919 predicted 628
6 SASI_Rn02_00240920 predicted 910
7 SASI_Rn02_00240921 predicted 694
8 SASI_Rn02_00240922 predicted 1009
9 SASI_Rn02_00240923 predicted 628
10 SASI_Rn02_00240924 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035138 predicted 374
2 SASI_Mm01_00035139 predicted 398
3 SASI_Mm01_00035140 predicted 232
4 SASI_Mm01_00035141 predicted 562
5 SASI_Mm01_00035142 predicted 500
6 SASI_Mm01_00035143 predicted 740
7 SASI_Mm01_00035144 predicted 242
8 SASI_Mm01_00035145 predicted 231
9 SASI_Mm01_00035146 predicted 248
10 SASI_Mm01_00035147 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032027
TM2D1 MISSION shRNA Bacterial Glycerol Stock
TM2 domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032027.2-499s21c1
Sequence:CCGGGCTACGCAAGAACCAGTTAACCTCGAGGTTAACTGGTTCTTGCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032027.2-629s21c1
Sequence:CCGGAGCCCATATCTTGCCGAAATGCTCGAGCATTTCGGCAAGATATGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-451s1c1
Sequence:CCGGGACCTCAAAGTGGGACAATATCTCGAGATATTGTCCCACTTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-581s1c1
Sequence:CCGGCCAGTGGCAATGAAACACATTCTCGAGAATGTGTTTCATTGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-809s1c1
Sequence:CCGGCAATGCAGATTGTTGGACCTTCTCGAGAAGGTCCAACAATCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-560s1c1
Sequence:CCGGCCAACATAACTTGTAAGGATTCTCGAGAATCCTTACAAGTTATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-867s1c1
Sequence:CCGGCAGACTTACAAGACTGAGTATCTCGAGATACTCAGTCTTGTAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-503s1c1
Sequence:CCGGCGCAAGAACCAGTTAACTGTACTCGAGTACAGTTAACTGGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032027.2-941s1c1
Sequence:CCGGGAAACAGATTTGAGCCTCCTTCTCGAGAAGGAGGCTCAAATCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032027
TM2D1 MISSION shRNA shRNA Plasmid DNA
TM2 domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032027.2-499s21c1
Sequence:CCGGGCTACGCAAGAACCAGTTAACCTCGAGGTTAACTGGTTCTTGCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032027.2-629s21c1
Sequence:CCGGAGCCCATATCTTGCCGAAATGCTCGAGCATTTCGGCAAGATATGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-451s1c1
Sequence:CCGGGACCTCAAAGTGGGACAATATCTCGAGATATTGTCCCACTTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-581s1c1
Sequence:CCGGCCAGTGGCAATGAAACACATTCTCGAGAATGTGTTTCATTGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-809s1c1
Sequence:CCGGCAATGCAGATTGTTGGACCTTCTCGAGAAGGTCCAACAATCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-560s1c1
Sequence:CCGGCCAACATAACTTGTAAGGATTCTCGAGAATCCTTACAAGTTATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-867s1c1
Sequence:CCGGCAGACTTACAAGACTGAGTATCTCGAGATACTCAGTCTTGTAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-503s1c1
Sequence:CCGGCGCAAGAACCAGTTAACTGTACTCGAGTACAGTTAACTGGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032027.2-941s1c1
Sequence:CCGGGAAACAGATTTGAGCCTCCTTCTCGAGAAGGAGGCTCAAATCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032027
TM2D1 MISSION shRNA Lentiviral Transduction Particles
TM2 domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032027.2-499s21c1
Sequence:CCGGGCTACGCAAGAACCAGTTAACCTCGAGGTTAACTGGTTCTTGCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032027.2-629s21c1
Sequence:CCGGAGCCCATATCTTGCCGAAATGCTCGAGCATTTCGGCAAGATATGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-451s1c1
Sequence:CCGGGACCTCAAAGTGGGACAATATCTCGAGATATTGTCCCACTTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-581s1c1
Sequence:CCGGCCAGTGGCAATGAAACACATTCTCGAGAATGTGTTTCATTGCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-809s1c1
Sequence:CCGGCAATGCAGATTGTTGGACCTTCTCGAGAAGGTCCAACAATCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-560s1c1
Sequence:CCGGCCAACATAACTTGTAAGGATTCTCGAGAATCCTTACAAGTTATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-867s1c1
Sequence:CCGGCAGACTTACAAGACTGAGTATCTCGAGATACTCAGTCTTGTAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032027.2-503s1c1
Sequence:CCGGCGCAAGAACCAGTTAACTGTACTCGAGTACAGTTAACTGGTTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032027.2-941s1c1
Sequence:CCGGGAAACAGATTTGAGCCTCCTTCTCGAGAAGGAGGCTCAAATCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053157
TM2D1 MISSION shRNA Bacterial Glycerol Stock
TM2 domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-232s21c1
Sequence:CCGGCGCAAGAACCAGTTAATTGTACTCGAGTACAATTAACTGGTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-402s21c1
Sequence:CCGGGCAGTTGCATTATCTCTCTTTCTCGAGAAAGAGAGATAATGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-370s21c1
Sequence:CCGGGCCGAAATGTGAATGGCTATTCTCGAGAATAGCCATTCACATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-300s21c1
Sequence:CCGGTGTAAGGATTTGAGTGGTAATCTCGAGATTACCACTCAAATCCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-202s1c1
Sequence:CCGGGCTACGCAAGAACCAGTTAATCTCGAGATTAACTGGTTCTTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-344s1c1
Sequence:CCGGGCCGAAATGTGAATGGCTATTCTCGAGAATAGCCATTCACATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-206s1c1
Sequence:CCGGCGCAAGAACCAGTTAATTGTACTCGAGTACAATTAACTGGTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-274s1c1
Sequence:CCGGTGTAAGGATTTGAGTGGTAATCTCGAGATTACCACTCAAATCCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-376s1c1
Sequence:CCGGGCAGTTGCATTATCTCTCTTTCTCGAGAAAGAGAGATAATGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053157
TM2D1 MISSION shRNA shRNA Plasmid DNA
TM2 domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-232s21c1
Sequence:CCGGCGCAAGAACCAGTTAATTGTACTCGAGTACAATTAACTGGTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-402s21c1
Sequence:CCGGGCAGTTGCATTATCTCTCTTTCTCGAGAAAGAGAGATAATGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-370s21c1
Sequence:CCGGGCCGAAATGTGAATGGCTATTCTCGAGAATAGCCATTCACATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-300s21c1
Sequence:CCGGTGTAAGGATTTGAGTGGTAATCTCGAGATTACCACTCAAATCCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-202s1c1
Sequence:CCGGGCTACGCAAGAACCAGTTAATCTCGAGATTAACTGGTTCTTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-344s1c1
Sequence:CCGGGCCGAAATGTGAATGGCTATTCTCGAGAATAGCCATTCACATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-206s1c1
Sequence:CCGGCGCAAGAACCAGTTAATTGTACTCGAGTACAATTAACTGGTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-274s1c1
Sequence:CCGGTGTAAGGATTTGAGTGGTAATCTCGAGATTACCACTCAAATCCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-376s1c1
Sequence:CCGGGCAGTTGCATTATCTCTCTTTCTCGAGAAAGAGAGATAATGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053157
TM2D1 MISSION shRNA Lentiviral Transduction Particles
TM2 domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-232s21c1
Sequence:CCGGCGCAAGAACCAGTTAATTGTACTCGAGTACAATTAACTGGTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-402s21c1
Sequence:CCGGGCAGTTGCATTATCTCTCTTTCTCGAGAAAGAGAGATAATGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-370s21c1
Sequence:CCGGGCCGAAATGTGAATGGCTATTCTCGAGAATAGCCATTCACATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053157.2-300s21c1
Sequence:CCGGTGTAAGGATTTGAGTGGTAATCTCGAGATTACCACTCAAATCCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-202s1c1
Sequence:CCGGGCTACGCAAGAACCAGTTAATCTCGAGATTAACTGGTTCTTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-344s1c1
Sequence:CCGGGCCGAAATGTGAATGGCTATTCTCGAGAATAGCCATTCACATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-206s1c1
Sequence:CCGGCGCAAGAACCAGTTAATTGTACTCGAGTACAATTAACTGGTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-274s1c1
Sequence:CCGGTGTAAGGATTTGAGTGGTAATCTCGAGATTACCACTCAAATCCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053157.1-376s1c1
Sequence:CCGGGCAGTTGCATTATCTCTCTTTCTCGAGAAAGAGAGATAATGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks