EMAIL THIS PAGE TO A FRIEND

TM2D2

TM2 domain containing 2

Synonyms: BLP1
UniProtKB ID: Q9BX73, B2RBK4, D3DSX8, Q8N0X9
Gene ID:
Human(83877) Summary: The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. This gene has multiple alternatively spliced transcript variants which encode two different isoforms. [provided by RefSeq, Jul 2008]
Mouse(69742) TM2 domain containing 2
Rat(290833) TM2 domain containing 2
domestic guinea pig(100727457) TM2 domain containing 2
naked mole-rat(101726670) TM2 domain containing 2
cow(507906) TM2 domain containing 2
Goat(100861359) TM2 domain containing 2
sheep(101114751) TM2 domain containing 2
chicken(426780) TM2 domain containing 2
dog(482850) TM2 domain containing 2
domestic cat(101085118) TM2 domain containing 2
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_078473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_078473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_078473 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024380 Rosetta Predictions human pricing
NM_001024381 Rosetta Predictions human pricing
NM_031940 Rosetta Predictions human pricing
NM_078473 Rosetta Predictions human pricing
NM_001017444 Rosetta Predictions rat pricing
NM_027194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050394 predicted 825
2 SASI_Hs01_00050395 predicted 700
3 SASI_Hs01_00050397 predicted 1050
4 SASI_Hs01_00050399 predicted 712
5 SASI_Hs01_00050400 predicted 699
6 SASI_Hs01_00050401 predicted 1291
7 SASI_Hs01_00050402 predicted 1368
8 SASI_Hs01_00050403 predicted 1387
9 SASI_Hs02_00307141 predicted 1119
10 SASI_Hs02_00307142 predicted 1351
11 SASI_Hs01_00050396 predicted 963
12 SASI_Hs01_00050398 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052658 predicted 724
2 SASI_Hs01_00052659 predicted 602
3 SASI_Hs01_00052661 predicted 947
4 SASI_Hs01_00052663 predicted 618
5 SASI_Hs01_00052664 predicted 603
6 SASI_Hs01_00052665 predicted 1188
7 SASI_Hs01_00052666 predicted 1263
8 SASI_Hs01_00052667 predicted 1293
9 SASI_Hs02_00307143 predicted 1022
10 SASI_Hs02_00307144 predicted 1251
11 SASI_Hs01_00052660 predicted 861
12 SASI_Hs01_00052662 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124327 predicted 1031
2 SASI_Hs01_00124328 predicted 908
3 SASI_Hs01_00124330 predicted 1253
4 SASI_Hs01_00124332 predicted 920
5 SASI_Hs01_00124333 predicted 906
6 SASI_Hs01_00124334 predicted 1498
7 SASI_Hs01_00124335 predicted 1570
8 SASI_Hs01_00124336 predicted 1591
9 SASI_Hs02_00359085 predicted 1324
10 SASI_Hs02_00359086 predicted 1563
11 SASI_Hs01_00124329 predicted 1163
12 SASI_Hs01_00124331 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081037 predicted 640
2 SASI_Hs01_00081038 predicted 521
3 SASI_Hs01_00081040 predicted 866
4 SASI_Hs01_00081042 predicted 531
5 SASI_Hs01_00081043 predicted 517
6 SASI_Hs01_00081044 predicted 1103
7 SASI_Hs01_00081045 predicted 1187
8 SASI_Hs01_00081046 predicted 1210
9 SASI_Hs02_00362161 predicted 937
10 SASI_Hs02_00362162 predicted 1172
11 SASI_Hs01_00081039 predicted 779
12 SASI_Hs01_00081041 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103919 predicted 911
2 SASI_Rn01_00103920 predicted 627
3 SASI_Rn01_00103921 predicted 733
4 SASI_Rn01_00103922 predicted 322
5 SASI_Rn01_00103923 predicted 360
6 SASI_Rn02_00202232 predicted 584
7 SASI_Rn01_00103924 predicted 685
8 SASI_Rn01_00103925 predicted 396
9 SASI_Rn01_00103926 predicted 791
10 SASI_Rn01_00103928 predicted 930
11 SASI_Rn01_00103927 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173186 predicted 906
2 SASI_Mm01_00173187 predicted 922
3 SASI_Mm01_00173188 predicted 288
4 SASI_Mm01_00173189 predicted 407
5 SASI_Mm01_00173190 predicted 858
6 SASI_Mm01_00173191 predicted 373
7 SASI_Mm01_00173192 predicted 281
8 SASI_Mm01_00173193 predicted 704
9 SASI_Mm01_00173194 predicted 901
10 SASI_Mm01_00173195 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078473
TM2D2 MISSION shRNA Bacterial Glycerol Stock
TM2 domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078473.1-500s1c1
Sequence:CCGGCTTCATAACCACTTTACTCTACTCGAGTAGAGTAAAGTGGTTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078473.1-297s1c1
Sequence:CCGGGAATGTGAAGACCCAGTGGATCTCGAGATCCACTGGGTCTTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078473.1-271s1c1
Sequence:CCGGGCTCTTACCTACCTGATGAATCTCGAGATTCATCAGGTAGGTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-445s21c1
Sequence:CCGGGCCATGCCTTAGATGGAATTGCTCGAGCAATTCCATCTAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-649s21c1
Sequence:CCGGGGTGGTTTGTTGACCTTATTTCTCGAGAAATAAGGTCAACAAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-517s21c1
Sequence:CCGGATACCGGACACTACTTCATAACTCGAGTTATGAAGTAGTGTCCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-304s21c1
Sequence:CCGGCTTACCTACCTGATGAATTTACTCGAGTAAATTCATCAGGTAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078473.2-1801s21c1
Sequence:CCGGCTCACTCAGTTTACCTAATAACTCGAGTTATTAGGTAAACTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078473
TM2D2 MISSION shRNA shRNA Plasmid DNA
TM2 domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078473.1-500s1c1
Sequence:CCGGCTTCATAACCACTTTACTCTACTCGAGTAGAGTAAAGTGGTTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078473.1-297s1c1
Sequence:CCGGGAATGTGAAGACCCAGTGGATCTCGAGATCCACTGGGTCTTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078473.1-271s1c1
Sequence:CCGGGCTCTTACCTACCTGATGAATCTCGAGATTCATCAGGTAGGTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-445s21c1
Sequence:CCGGGCCATGCCTTAGATGGAATTGCTCGAGCAATTCCATCTAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-649s21c1
Sequence:CCGGGGTGGTTTGTTGACCTTATTTCTCGAGAAATAAGGTCAACAAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-517s21c1
Sequence:CCGGATACCGGACACTACTTCATAACTCGAGTTATGAAGTAGTGTCCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-304s21c1
Sequence:CCGGCTTACCTACCTGATGAATTTACTCGAGTAAATTCATCAGGTAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078473.2-1801s21c1
Sequence:CCGGCTCACTCAGTTTACCTAATAACTCGAGTTATTAGGTAAACTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078473
TM2D2 MISSION shRNA Lentiviral Transduction Particles
TM2 domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078473.1-500s1c1
Sequence:CCGGCTTCATAACCACTTTACTCTACTCGAGTAGAGTAAAGTGGTTATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078473.1-297s1c1
Sequence:CCGGGAATGTGAAGACCCAGTGGATCTCGAGATCCACTGGGTCTTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_078473.1-271s1c1
Sequence:CCGGGCTCTTACCTACCTGATGAATCTCGAGATTCATCAGGTAGGTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-445s21c1
Sequence:CCGGGCCATGCCTTAGATGGAATTGCTCGAGCAATTCCATCTAAGGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-649s21c1
Sequence:CCGGGGTGGTTTGTTGACCTTATTTCTCGAGAAATAAGGTCAACAAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-517s21c1
Sequence:CCGGATACCGGACACTACTTCATAACTCGAGTTATGAAGTAGTGTCCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078473.2-304s21c1
Sequence:CCGGCTTACCTACCTGATGAATTTACTCGAGTAAATTCATCAGGTAGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078473.2-1801s21c1
Sequence:CCGGCTCACTCAGTTTACCTAATAACTCGAGTTATTAGGTAAACTGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027194
VALIDATED
TM2D2 MISSION shRNA Bacterial Glycerol Stock
TM2 domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-179s21c1
Sequence:CCGGTTCTCGGAGCCACTCGTTTAACTCGAGTTAAACGAGTGGCTCCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-652s21c1
Sequence:CCGGGGTGGTTCGTTGATCTTATTCCTCGAGGAATAAGATCAACGAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-385s21c1
Sequence:CCGGGTTATGGTTGTCTCAAGTTTGCTCGAGCAAACTTGAGACAACCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-880s21c1
Sequence:CCGGACTAGAGTGACAAGCAGTATTCTCGAGAATACTGCTTGTCACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-520s21c1
Sequence:CCGGACACTGGACACTACTTCATAACTCGAGTTATGAAGTAGTGTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027194
VALIDATED
TM2D2 MISSION shRNA shRNA Plasmid DNA
TM2 domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-179s21c1
Sequence:CCGGTTCTCGGAGCCACTCGTTTAACTCGAGTTAAACGAGTGGCTCCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-652s21c1
Sequence:CCGGGGTGGTTCGTTGATCTTATTCCTCGAGGAATAAGATCAACGAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-385s21c1
Sequence:CCGGGTTATGGTTGTCTCAAGTTTGCTCGAGCAAACTTGAGACAACCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-880s21c1
Sequence:CCGGACTAGAGTGACAAGCAGTATTCTCGAGAATACTGCTTGTCACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-520s21c1
Sequence:CCGGACACTGGACACTACTTCATAACTCGAGTTATGAAGTAGTGTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027194
VALIDATED
TM2D2 MISSION shRNA Lentiviral Transduction Particles
TM2 domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-179s21c1
Sequence:CCGGTTCTCGGAGCCACTCGTTTAACTCGAGTTAAACGAGTGGCTCCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-652s21c1
Sequence:CCGGGGTGGTTCGTTGATCTTATTCCTCGAGGAATAAGATCAACGAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-385s21c1
Sequence:CCGGGTTATGGTTGTCTCAAGTTTGCTCGAGCAAACTTGAGACAACCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-880s21c1
Sequence:CCGGACTAGAGTGACAAGCAGTATTCTCGAGAATACTGCTTGTCACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027194.2-520s21c1
Sequence:CCGGACACTGGACACTACTTCATAACTCGAGTTATGAAGTAGTGTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks