EMAIL THIS PAGE TO A FRIEND

TM2D3

TM2 domain containing 3

Synonyms: BLP2
UniProtKB ID: Q9BRN9, B2RDK9, Q9H046, Q9H651
Gene ID:
Human(80213) Summary: The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. Several alternatively spliced transcript variants of this gene are described but the full length nature of some variants has not been determined. Multiple polyadenylation sites have been found in this gene. [provided by RefSeq, Jul 2008]
Mouse(68634) TM2 domain containing 3
Rat(292995) TM2 domain containing 3
Zebrafish(100093711) TM2 domain containing 3
chicken(415390) TM2 domain containing 3
domestic cat(101081550) TM2 domain containing 3
dog(479020) TM2 domain containing 3
cow(512588) TM2 domain containing 3
sheep(101119939) TM2 domain containing 3
naked mole-rat(101697878) TM2 domain containing 3
domestic guinea pig(100714237) TM2 domain containing 3
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU184961 MISSION® esiRNA esiRNA targeting mouse Tm2d3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025141 Rosetta Predictions human pricing
NM_078474 Rosetta Predictions human pricing
NM_001106267 Rosetta Predictions rat pricing
NM_026795 Rosetta Predictions mouse pricing
NM_178056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176500 predicted 345
2 SASI_Hs01_00176501 predicted 751
3 SASI_Hs01_00176503 predicted 853
4 SASI_Hs01_00176504 predicted 479
5 SASI_Hs01_00176506 predicted 992
6 SASI_Hs02_00357868 predicted 815
7 SASI_Hs02_00357869 predicted 1020
8 SASI_Hs01_00176507 predicted 672
9 SASI_Hs01_00176508 predicted 837
10 SASI_Hs01_00176509 predicted 613
11 SASI_Hs01_00176502 predicted 819
12 SASI_Hs01_00176505 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124149 predicted 425
2 SASI_Hs01_00124150 predicted 824
3 SASI_Hs01_00124152 predicted 923
4 SASI_Hs01_00124153 predicted 557
5 SASI_Hs01_00124155 predicted 1069
6 SASI_Hs02_00362163 predicted 891
7 SASI_Hs02_00362164 predicted 1095
8 SASI_Hs01_00124156 predicted 757
9 SASI_Hs01_00124157 predicted 921
10 SASI_Hs01_00124158 predicted 695
11 SASI_Hs01_00124151 predicted 891
12 SASI_Hs01_00124154 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217288 predicted 747
2 SASI_Rn02_00217289 predicted 966
3 SASI_Rn02_00217290 predicted 1164
4 SASI_Rn02_00217291 predicted 1045
5 SASI_Rn02_00217292 predicted 891
6 SASI_Rn02_00217293 predicted 835
7 SASI_Rn02_00217294 predicted 882
8 SASI_Rn02_00217295 predicted 688
9 SASI_Rn02_00217296 predicted 776
10 SASI_Rn02_00217297 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074942 predicted 526
2 SASI_Mm01_00074943 predicted 402
3 SASI_Mm02_00330913 predicted 413
4 SASI_Mm02_00330914 predicted 684
5 SASI_Mm02_00330915 predicted 682
6 SASI_Mm02_00330916 predicted 632
7 SASI_Mm02_00330917 predicted 602
8 SASI_Mm01_00074948 predicted 354
9 SASI_Mm02_00330918 predicted 684
10 SASI_Mm02_00330919 predicted 683
11 SASI_Mm01_00074944 predicted 255
12 SASI_Mm01_00074945 predicted 223
13 SASI_Mm01_00074946 predicted 366
14 SASI_Mm01_00074947 predicted 498
15 SASI_Mm01_00074949 predicted 286
16 SASI_Mm01_00074950 predicted 434
17 SASI_Mm01_00074951 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072067 predicted 621
2 SASI_Mm01_00072068 predicted 499
3 SASI_Mm01_00072069 predicted 503
4 SASI_Mm02_00348515 predicted 780
5 SASI_Mm02_00348516 predicted 777
6 SASI_Mm01_00072070 predicted 724
7 SASI_Mm01_00072072 predicted 693
8 SASI_Mm01_00072074 predicted 448
9 SASI_Mm02_00348517 predicted 774
10 SASI_Mm02_00348518 predicted 774
11 SASI_Mm01_00072071 predicted 1111
12 SASI_Mm01_00072073 predicted 1244
13 SASI_Mm01_00072075 predicted 1234
14 SASI_Mm01_00072076 predicted 1184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025141
VALIDATED
TM2D3 MISSION shRNA Bacterial Glycerol Stock
TM2 domain containing 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025141.3-275s21c1
Sequence:CCGGGTGTTGATCAAGACTTCAAATCTCGAGATTTGAAGTCTTGATCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025141.3-839s21c1
Sequence:CCGGGAAACGCTGAACTATGCTAATCTCGAGATTAGCATAGTTCAGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025141.3-1131s21c1
Sequence:CCGCGTTGGCTAATTGAAGTTATTACTCGAGTAATAACTTCAATTAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-178s1c1
Sequence:CCGGCAGACTGTATAGACTGCACAACTCGAGTTGTGCAGTCTATACAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025141.2-302s1c1
Sequence:CCGGCATTAACATGACTTGCAGATTCTCGAGAATCTGCAAGTCATGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025141.2-806s1c1
Sequence:CCGGGCCTTGATAAAGGTAAGATAACTCGAGTTATCTTACCTTTATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025141.2-1148s1c1
Sequence:CCGGGCTTCAGTCATGTGTAAGTTTCTCGAGAAACTTACACATGACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025141.2-241s1c1
Sequence:CCGGGTGCAGTGAAACCATCTGTTACTCGAGTAACAGATGGTTTCACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-135s1c1
Sequence:CCGGGTGATGAAGTGTCCGAGCAATCTCGAGATTGCTCGGACACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-148s1c1
Sequence:CCGGCGAGCAATGGTTTGTGTAGCACTCGAGTGCTACACAAACCATTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025141.2-997s1c1
Sequence:CCGGCACTTGTATCTCCAGCCCAAACTCGAGTTTGGGCTGGAGATACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-475s1c1
Sequence:CCGGGCAATTGGACTGGAGGCTATACTCGAGTATAGCCTCCAGTCCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-145s1c1
Sequence:CCGGGTCCGAGCAATGGTTTGTGTACTCGAGTACACAAACCATTGCTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025141.2-1013s1c1
Sequence:CCGGCCAAATGTAGTCTGCCTTGAACTCGAGTTCAAGGCAGACTACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025141
VALIDATED
TM2D3 MISSION shRNA shRNA Plasmid DNA
TM2 domain containing 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025141.3-275s21c1
Sequence:CCGGGTGTTGATCAAGACTTCAAATCTCGAGATTTGAAGTCTTGATCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025141.3-839s21c1
Sequence:CCGGGAAACGCTGAACTATGCTAATCTCGAGATTAGCATAGTTCAGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025141.3-1131s21c1
Sequence:CCGCGTTGGCTAATTGAAGTTATTACTCGAGTAATAACTTCAATTAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-178s1c1
Sequence:CCGGCAGACTGTATAGACTGCACAACTCGAGTTGTGCAGTCTATACAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025141.2-302s1c1
Sequence:CCGGCATTAACATGACTTGCAGATTCTCGAGAATCTGCAAGTCATGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025141.2-806s1c1
Sequence:CCGGGCCTTGATAAAGGTAAGATAACTCGAGTTATCTTACCTTTATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025141.2-1148s1c1
Sequence:CCGGGCTTCAGTCATGTGTAAGTTTCTCGAGAAACTTACACATGACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025141.2-241s1c1
Sequence:CCGGGTGCAGTGAAACCATCTGTTACTCGAGTAACAGATGGTTTCACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-135s1c1
Sequence:CCGGGTGATGAAGTGTCCGAGCAATCTCGAGATTGCTCGGACACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-148s1c1
Sequence:CCGGCGAGCAATGGTTTGTGTAGCACTCGAGTGCTACACAAACCATTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025141.2-997s1c1
Sequence:CCGGCACTTGTATCTCCAGCCCAAACTCGAGTTTGGGCTGGAGATACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-475s1c1
Sequence:CCGGGCAATTGGACTGGAGGCTATACTCGAGTATAGCCTCCAGTCCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-145s1c1
Sequence:CCGGGTCCGAGCAATGGTTTGTGTACTCGAGTACACAAACCATTGCTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025141.2-1013s1c1
Sequence:CCGGCCAAATGTAGTCTGCCTTGAACTCGAGTTCAAGGCAGACTACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025141
VALIDATED
TM2D3 MISSION shRNA Lentiviral Transduction Particles
TM2 domain containing 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025141.3-275s21c1
Sequence:CCGGGTGTTGATCAAGACTTCAAATCTCGAGATTTGAAGTCTTGATCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025141.3-839s21c1
Sequence:CCGGGAAACGCTGAACTATGCTAATCTCGAGATTAGCATAGTTCAGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025141.3-1131s21c1
Sequence:CCGCGTTGGCTAATTGAAGTTATTACTCGAGTAATAACTTCAATTAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-178s1c1
Sequence:CCGGCAGACTGTATAGACTGCACAACTCGAGTTGTGCAGTCTATACAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025141.2-302s1c1
Sequence:CCGGCATTAACATGACTTGCAGATTCTCGAGAATCTGCAAGTCATGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025141.2-806s1c1
Sequence:CCGGGCCTTGATAAAGGTAAGATAACTCGAGTTATCTTACCTTTATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025141.2-1148s1c1
Sequence:CCGGGCTTCAGTCATGTGTAAGTTTCTCGAGAAACTTACACATGACTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025141.2-241s1c1
Sequence:CCGGGTGCAGTGAAACCATCTGTTACTCGAGTAACAGATGGTTTCACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-135s1c1
Sequence:CCGGGTGATGAAGTGTCCGAGCAATCTCGAGATTGCTCGGACACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-148s1c1
Sequence:CCGGCGAGCAATGGTTTGTGTAGCACTCGAGTGCTACACAAACCATTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141166    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025141.2-997s1c1
Sequence:CCGGCACTTGTATCTCCAGCCCAAACTCGAGTTTGGGCTGGAGATACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-475s1c1
Sequence:CCGGGCAATTGGACTGGAGGCTATACTCGAGTATAGCCTCCAGTCCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025141.2-145s1c1
Sequence:CCGGGTCCGAGCAATGGTTTGTGTACTCGAGTACACAAACCATTGCTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025141.2-1013s1c1
Sequence:CCGGCCAAATGTAGTCTGCCTTGAACTCGAGTTCAAGGCAGACTACATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026795
TM2D3 MISSION shRNA Bacterial Glycerol Stock
TM2 domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-315s1c1
Sequence:CCGGCCAGAGGAACTTCGTCATCAACTCGAGTTGATGACGAAGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-210s1c1
Sequence:CCGGCTGTATAGAATGTGCGACCAACTCGAGTTGGTCGCACATTCTATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-91s1c1
Sequence:CCGGTGCTACATTCTGTCGGGAGATCTCGAGATCTCCCGACAGAATGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-633s1c1
Sequence:CCGGCCTGGGAATATGGACCCTAATCTCGAGATTAGGGTCCATATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-655s1c1
Sequence:CCGGGATGTCTTGCTGATTGGAGTTCTCGAGAACTCCAATCAGCAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026795
TM2D3 MISSION shRNA shRNA Plasmid DNA
TM2 domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-315s1c1
Sequence:CCGGCCAGAGGAACTTCGTCATCAACTCGAGTTGATGACGAAGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-210s1c1
Sequence:CCGGCTGTATAGAATGTGCGACCAACTCGAGTTGGTCGCACATTCTATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-91s1c1
Sequence:CCGGTGCTACATTCTGTCGGGAGATCTCGAGATCTCCCGACAGAATGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-633s1c1
Sequence:CCGGCCTGGGAATATGGACCCTAATCTCGAGATTAGGGTCCATATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-655s1c1
Sequence:CCGGGATGTCTTGCTGATTGGAGTTCTCGAGAACTCCAATCAGCAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026795
TM2D3 MISSION shRNA Lentiviral Transduction Particles
TM2 domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-315s1c1
Sequence:CCGGCCAGAGGAACTTCGTCATCAACTCGAGTTGATGACGAAGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-210s1c1
Sequence:CCGGCTGTATAGAATGTGCGACCAACTCGAGTTGGTCGCACATTCTATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-91s1c1
Sequence:CCGGTGCTACATTCTGTCGGGAGATCTCGAGATCTCCCGACAGAATGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-633s1c1
Sequence:CCGGCCTGGGAATATGGACCCTAATCTCGAGATTAGGGTCCATATTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026795.1-655s1c1
Sequence:CCGGGATGTCTTGCTGATTGGAGTTCTCGAGAACTCCAATCAGCAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks