EMAIL THIS PAGE TO A FRIEND

TM4SF18

transmembrane 4 L six family member 18

Synonyms: L6D
UniProtKB ID: Q96CE8, B2R8K0, D3DNH5
Gene ID:
Zebrafish(563601) transmembrane 4 L six family member 18
dog(477107) transmembrane 4 L six family member 18
chicken(771841) transmembrane 4 L six family member 18
cow(507280) transmembrane 4 L six family member 18
sheep(101121735) transmembrane 4 L six family member 18
naked mole-rat(101720911) transmembrane 4 L six family member 18
domestic guinea pig(100717304) transmembrane 4 L six family member 18
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138786 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008501 MISSION® esiRNA esiRNA targeting human TM4SF18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138786 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227789 predicted 239
2 SASI_Hs02_00363911 predicted 585
3 SASI_Hs01_00227791 predicted 199
4 SASI_Hs02_00363912 predicted 296
5 SASI_Hs02_00363913 predicted 534
6 SASI_Hs01_00227795 predicted 550
7 SASI_Hs01_00227796 predicted 339
8 SASI_Hs02_00363914 predicted 400
9 SASI_Hs02_00363915 predicted 352
10 SASI_Hs02_00363916 predicted 676
11 SASI_Hs01_00227790 predicted 292
12 SASI_Hs01_00227792 predicted 599
13 SASI_Hs01_00227793 predicted 710
14 SASI_Hs01_00227794 predicted 296
15 SASI_Hs01_00227797 predicted 241
16 SASI_Hs01_00227798 predicted 558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138786
TM4SF18 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138786.2-772s21c1
Sequence:CCGGGACATGGCCATCTATCTAAATCTCGAGATTTAGATAGATGGCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138786.2-806s21c1
Sequence:CCGGTGTAGACTTGAGGGCAATATTCTCGAGAATATTGCCCTCAAGTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138786.1-955s1c1
Sequence:CCGGGAAATACTTCTGCCCTTTGATCTCGAGATCAAAGGGCAGAAGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-259s1c1
Sequence:CCGGCAGCAATAAACTCACCAACTACTCGAGTAGTTGGTGAGTTTATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-190s1c1
Sequence:CCGGGCTTGCACTTTGGAGTATAATCTCGAGATTATACTCCAAAGTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138786.1-995s1c1
Sequence:CCGGGAATCTGTACTAGGGAAGTAACTCGAGTTACTTCCCTAGTACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-545s1c1
Sequence:CCGGGCTGGACGTTTCCTTACAGATCTCGAGATCTGTAAGGAAACGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138786.1-968s1c1
Sequence:CCGGCCTTTGATCAAACAAATCCATCTCGAGATGGATTTGTTTGATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-233s1c1
Sequence:CCGGCCGAATGGGCAAACTTCCTATCTCGAGATAGGAAGTTTGCCCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138786
TM4SF18 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138786.2-772s21c1
Sequence:CCGGGACATGGCCATCTATCTAAATCTCGAGATTTAGATAGATGGCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138786.2-806s21c1
Sequence:CCGGTGTAGACTTGAGGGCAATATTCTCGAGAATATTGCCCTCAAGTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138786.1-955s1c1
Sequence:CCGGGAAATACTTCTGCCCTTTGATCTCGAGATCAAAGGGCAGAAGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-259s1c1
Sequence:CCGGCAGCAATAAACTCACCAACTACTCGAGTAGTTGGTGAGTTTATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-190s1c1
Sequence:CCGGGCTTGCACTTTGGAGTATAATCTCGAGATTATACTCCAAAGTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138786.1-995s1c1
Sequence:CCGGGAATCTGTACTAGGGAAGTAACTCGAGTTACTTCCCTAGTACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-545s1c1
Sequence:CCGGGCTGGACGTTTCCTTACAGATCTCGAGATCTGTAAGGAAACGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138786.1-968s1c1
Sequence:CCGGCCTTTGATCAAACAAATCCATCTCGAGATGGATTTGTTTGATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-233s1c1
Sequence:CCGGCCGAATGGGCAAACTTCCTATCTCGAGATAGGAAGTTTGCCCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138786
TM4SF18 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138786.2-772s21c1
Sequence:CCGGGACATGGCCATCTATCTAAATCTCGAGATTTAGATAGATGGCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138786.2-806s21c1
Sequence:CCGGTGTAGACTTGAGGGCAATATTCTCGAGAATATTGCCCTCAAGTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145478    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138786.1-955s1c1
Sequence:CCGGGAAATACTTCTGCCCTTTGATCTCGAGATCAAAGGGCAGAAGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-259s1c1
Sequence:CCGGCAGCAATAAACTCACCAACTACTCGAGTAGTTGGTGAGTTTATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-190s1c1
Sequence:CCGGGCTTGCACTTTGGAGTATAATCTCGAGATTATACTCCAAAGTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138786.1-995s1c1
Sequence:CCGGGAATCTGTACTAGGGAAGTAACTCGAGTTACTTCCCTAGTACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-545s1c1
Sequence:CCGGGCTGGACGTTTCCTTACAGATCTCGAGATCTGTAAGGAAACGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138786.1-968s1c1
Sequence:CCGGCCTTTGATCAAACAAATCCATCTCGAGATGGATTTGTTTGATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138786.1-233s1c1
Sequence:CCGGCCGAATGGGCAAACTTCCTATCTCGAGATAGGAAGTTTGCCCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks