EMAIL THIS PAGE TO A FRIEND

TM4SF19

transmembrane 4 L six family member 19

UniProtKB ID: Q96DZ7, B2RV20, E9PH22, Q336K7
Gene ID:
Mouse(277203) transmembrane 4 L six family member 19
Rat(288044) transmembrane 4 L six family member 19
domestic guinea pig(100715072) transmembrane 4 L six family member 19
naked mole-rat(101706773) transmembrane 4 L six family member 19
cow(101906348) transmembrane 4 L six family member 19
sheep(101121225) transmembrane 4 L six family member 19
chicken(424855) transmembrane 4 L six family member 19
dog(609444) transmembrane 4 L six family member 19
Horse(100069913) transmembrane 4 L six family member 19
domestic cat(101100076) transmembrane 4 L six family member 19
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138461 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001160402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138461 Rosetta Predictions human pricing
NM_001105873 Rosetta Predictions rat pricing
XM_205829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363638 predicted 518
2 SASI_Hs01_00133384 predicted 390
3 SASI_Hs01_00133385 predicted 363
4 SASI_Hs01_00133386 predicted 333
5 SASI_Hs01_00133387 predicted 404
6 SASI_Hs01_00133389 predicted 418
7 SASI_Hs02_00363639 predicted 411
8 SASI_Hs01_00133393 predicted 469
9 SASI_Hs02_00363640 predicted 368
10 SASI_Hs02_00363641 predicted 398
11 SASI_Hs01_00133388 predicted 542
12 SASI_Hs01_00133390 predicted 741
13 SASI_Hs01_00133391 predicted 446
14 SASI_Hs01_00133392 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213372 predicted 539
2 SASI_Rn02_00213373 predicted 410
3 SASI_Rn02_00213374 predicted 530
4 SASI_Rn02_00213375 predicted 405
5 SASI_Rn02_00213376 predicted 507
6 SASI_Rn02_00213377 predicted 513
7 SASI_Rn02_00213378 predicted 477
8 SASI_Rn02_00213379 predicted 476
9 SASI_Rn02_00213380 predicted 536
10 SASI_Rn02_00213381 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_205829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425602 predicted 528
2 SASI_Mm01_00257458 predicted 528
3 SASI_Mm02_00425603 predicted 569
4 SASI_Mm02_00425604 predicted 747
5 SASI_Mm02_00425605 predicted 725
6 SASI_Mm01_00257459 predicted 434
7 SASI_Mm02_00425606 predicted 445
8 SASI_Mm01_00257460 predicted 465
9 SASI_Mm01_00257462 predicted 439
10 SASI_Mm01_00257465 predicted 498
11 SASI_Mm01_00257461 predicted 465
12 SASI_Mm01_00257463 predicted 250
13 SASI_Mm01_00257464 predicted 544
14 SASI_Mm01_00257466 predicted 496
15 SASI_Mm01_00257467 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138461
TM4SF19 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138461.1-823s1c1
Sequence:CCGGCCTCTGTGGTTAAAGACTGTACTCGAGTACAGTCTTTAACCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-421s1c1
Sequence:CCGGGCTTTACTTGGAGCCCTGATTCTCGAGAATCAGGGCTCCAAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138461.1-687s1c1
Sequence:CCGGCGTTCATGTCATCAACAGCCTCTCGAGAGGCTGTTGATGACATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-351s1c1
Sequence:CCGGGAGATACGGCTGCTTCAGTAACTCGAGTTACTGAAGCAGCCGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-549s1c1
Sequence:CCGGCCTGCATAGTAGGAATTATCTCTCGAGAGATAATTCCTACTATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-539s1c1
Sequence:CCGGCATTCAAAGACCTGCATAGTACTCGAGTACTATGCAGGTCTTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138461.1-511s1c1
Sequence:CCGGCAGACACAAGCTTGGAAATATCTCGAGATATTTCCAAGCTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138461.2-393s21c1
Sequence:CCGGCTCTGTCGAAGCGTGCTTACTCTCGAGAGTAAGCACGCTTCGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138461.2-531s21c1
Sequence:CCAGCAAGCTTGGAAATATGGTTACCTCGAGGTAACCATATTTCCAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138461.2-856s21c1
Sequence:CCGGTAGGTATCCCTGGAGTAATAACTCGAGTTATTACTCCAGGGATACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138461
TM4SF19 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138461.1-823s1c1
Sequence:CCGGCCTCTGTGGTTAAAGACTGTACTCGAGTACAGTCTTTAACCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-421s1c1
Sequence:CCGGGCTTTACTTGGAGCCCTGATTCTCGAGAATCAGGGCTCCAAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138461.1-687s1c1
Sequence:CCGGCGTTCATGTCATCAACAGCCTCTCGAGAGGCTGTTGATGACATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-351s1c1
Sequence:CCGGGAGATACGGCTGCTTCAGTAACTCGAGTTACTGAAGCAGCCGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-549s1c1
Sequence:CCGGCCTGCATAGTAGGAATTATCTCTCGAGAGATAATTCCTACTATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-539s1c1
Sequence:CCGGCATTCAAAGACCTGCATAGTACTCGAGTACTATGCAGGTCTTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138461.1-511s1c1
Sequence:CCGGCAGACACAAGCTTGGAAATATCTCGAGATATTTCCAAGCTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138461.2-393s21c1
Sequence:CCGGCTCTGTCGAAGCGTGCTTACTCTCGAGAGTAAGCACGCTTCGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138461.2-531s21c1
Sequence:CCAGCAAGCTTGGAAATATGGTTACCTCGAGGTAACCATATTTCCAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138461.2-856s21c1
Sequence:CCGGTAGGTATCCCTGGAGTAATAACTCGAGTTATTACTCCAGGGATACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138461
TM4SF19 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138461.1-823s1c1
Sequence:CCGGCCTCTGTGGTTAAAGACTGTACTCGAGTACAGTCTTTAACCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-421s1c1
Sequence:CCGGGCTTTACTTGGAGCCCTGATTCTCGAGAATCAGGGCTCCAAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138461.1-687s1c1
Sequence:CCGGCGTTCATGTCATCAACAGCCTCTCGAGAGGCTGTTGATGACATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-351s1c1
Sequence:CCGGGAGATACGGCTGCTTCAGTAACTCGAGTTACTGAAGCAGCCGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-549s1c1
Sequence:CCGGCCTGCATAGTAGGAATTATCTCTCGAGAGATAATTCCTACTATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138461.1-539s1c1
Sequence:CCGGCATTCAAAGACCTGCATAGTACTCGAGTACTATGCAGGTCTTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138461.1-511s1c1
Sequence:CCGGCAGACACAAGCTTGGAAATATCTCGAGATATTTCCAAGCTTGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138461.2-393s21c1
Sequence:CCGGCTCTGTCGAAGCGTGCTTACTCTCGAGAGTAAGCACGCTTCGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138461.2-531s21c1
Sequence:CCAGCAAGCTTGGAAATATGGTTACCTCGAGGTAACCATATTTCCAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138461.2-856s21c1
Sequence:CCGGTAGGTATCCCTGGAGTAATAACTCGAGTTATTACTCCAGGGATACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160402
TM4SF19 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-984s21c1
Sequence:CCGGTGGCCATCCATCTTGTCAATACTCGAGTATTGACAAGATGGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160402.1-1047s21c1
Sequence:CCGGTAACGGATGCCCTCTCGTGAACTCGAGTTCACGAGAGGGCATCCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-792s21c1
Sequence:CCGGTTGATGTCTCATCCTTCAATCCTCGAGGATTGAAGGATGAGACATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-825s21c1
Sequence:CCGGGGAAATTCGGCTATCCCTTTACTCGAGTAAAGGGATAGCCGAATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-849s21c1
Sequence:CCGGATCTACACAACAGGAATTATCCTCGAGGATAATTCCTGTTGTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160402
TM4SF19 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-984s21c1
Sequence:CCGGTGGCCATCCATCTTGTCAATACTCGAGTATTGACAAGATGGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160402.1-1047s21c1
Sequence:CCGGTAACGGATGCCCTCTCGTGAACTCGAGTTCACGAGAGGGCATCCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-792s21c1
Sequence:CCGGTTGATGTCTCATCCTTCAATCCTCGAGGATTGAAGGATGAGACATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-825s21c1
Sequence:CCGGGGAAATTCGGCTATCCCTTTACTCGAGTAAAGGGATAGCCGAATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-849s21c1
Sequence:CCGGATCTACACAACAGGAATTATCCTCGAGGATAATTCCTGTTGTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160402
TM4SF19 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-984s21c1
Sequence:CCGGTGGCCATCCATCTTGTCAATACTCGAGTATTGACAAGATGGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160402.1-1047s21c1
Sequence:CCGGTAACGGATGCCCTCTCGTGAACTCGAGTTCACGAGAGGGCATCCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-792s21c1
Sequence:CCGGTTGATGTCTCATCCTTCAATCCTCGAGGATTGAAGGATGAGACATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-825s21c1
Sequence:CCGGGGAAATTCGGCTATCCCTTTACTCGAGTAAAGGGATAGCCGAATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160402.1-849s21c1
Sequence:CCGGATCTACACAACAGGAATTATCCTCGAGGATAATTCCTGTTGTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks