EMAIL THIS PAGE TO A FRIEND

TM4SF1

transmembrane 4 L six family member 1

Synonyms: H-L6 L6 M3S1 TAAL6
UniProtKB ID: P30408, Q6IB51
Gene ID:
Human(4071) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface antigen and is highly expressed in different carcinomas. [provided by RefSeq, Jul 2008]
Mouse(17112) transmembrane 4 superfamily member 1
Rat(295061) transmembrane 4 L six family member 1
chicken(425046) transmembrane 4 L six family member 1
dog(485710) transmembrane 4 L six family member 1
domestic cat(101101157) transmembrane 4 L six family member 1
domestic guinea pig(100716852) transmembrane 4 L six family member 1
naked mole-rat(101721271) transmembrane 4 L six family member 1
cow(533038) transmembrane 4 L six family member 1
sheep(101121479) transmembrane 4 L six family member 1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014220 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014220 siRNAs that have been validated in the lab human pricing
NM_001106434 Rosetta Predictions rat pricing
NM_008536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014220 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207051 validated 480
2 SASI_Hs01_00207052 predicted 496
3 SASI_Hs01_00207053 predicted 695
4 SASI_Hs01_00207054 predicted 280
5 SASI_Hs02_00345248 predicted 657
6 SASI_Hs01_00207056 predicted 1290
7 SASI_Hs01_00207057 predicted 685
8 SASI_Hs01_00207058 predicted 284
9 SASI_Hs01_00207060 predicted 1319
10 SASI_Hs02_00345249 predicted 1269
11 SASI_Hs01_00207055 predicted 757
12 SASI_Hs01_00207059 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218928 predicted 339
2 SASI_Rn02_00218929 predicted 847
3 SASI_Rn02_00218930 predicted 965
4 SASI_Rn02_00218931 predicted 602
5 SASI_Rn02_00218932 predicted 697
6 SASI_Rn02_00218933 predicted 478
7 SASI_Rn02_00218934 predicted 737
8 SASI_Rn02_00218935 predicted 910
9 SASI_Rn02_00218936 predicted 393
10 SASI_Rn02_00218937 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180057 predicted 1040
2 SASI_Mm01_00180058 predicted 786
3 SASI_Mm01_00180059 predicted 669
4 SASI_Mm01_00180060 predicted 1276
5 SASI_Mm01_00180061 predicted 604
6 SASI_Mm01_00180062 predicted 1242
7 SASI_Mm01_00180063 predicted 1038
8 SASI_Mm01_00180065 predicted 949
9 SASI_Mm01_00180066 predicted 911
10 SASI_Mm02_00314130 predicted 1189
11 SASI_Mm01_00180064 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008536
VALIDATED
TM4SF1 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-739s1c1
Sequence:CCGGGCTTCCTGTATTTCACTGTAACTCGAGTTACAGTGAAATACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-180s1c1
Sequence:CCGGGCTTTGCTCTACTTTCCTAATCTCGAGATTAGGAAAGTAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-629s1c1
Sequence:CCGGCTTGTGTCTCATTCAAGTAATCTCGAGATTACTTGAATGAGACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-692s1c1
Sequence:CCGGCCAACAGCAATATAACTGCTACTCGAGTAGCAGTTATATTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-428s1c1
Sequence:CCGGCATTGTGGCATCACTGGGTTTCTCGAGAAACCCAGTGATGCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008536.3-1126s21c1
Sequence:CCGGCTTGTGTCTCATTCAAGTAATCTCGAGATTACTTGAATGAGACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008536.3-1236s21c1
Sequence:CCGGGCTTCCTGTATTTCACTGTAACTCGAGTTACAGTGAAATACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008536.3-677s21c1
Sequence:CCGGGCTTTGCTCTACTTTCCTAATCTCGAGATTAGGAAAGTAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008536.3-925s21c1
Sequence:CCGGCATTGTGGCATCACTGGGTTTCTCGAGAAACCCAGTGATGCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008536
VALIDATED
TM4SF1 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-739s1c1
Sequence:CCGGGCTTCCTGTATTTCACTGTAACTCGAGTTACAGTGAAATACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-180s1c1
Sequence:CCGGGCTTTGCTCTACTTTCCTAATCTCGAGATTAGGAAAGTAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-629s1c1
Sequence:CCGGCTTGTGTCTCATTCAAGTAATCTCGAGATTACTTGAATGAGACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-692s1c1
Sequence:CCGGCCAACAGCAATATAACTGCTACTCGAGTAGCAGTTATATTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-428s1c1
Sequence:CCGGCATTGTGGCATCACTGGGTTTCTCGAGAAACCCAGTGATGCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008536.3-1126s21c1
Sequence:CCGGCTTGTGTCTCATTCAAGTAATCTCGAGATTACTTGAATGAGACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008536.3-1236s21c1
Sequence:CCGGGCTTCCTGTATTTCACTGTAACTCGAGTTACAGTGAAATACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008536.3-677s21c1
Sequence:CCGGGCTTTGCTCTACTTTCCTAATCTCGAGATTAGGAAAGTAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008536.3-925s21c1
Sequence:CCGGCATTGTGGCATCACTGGGTTTCTCGAGAAACCCAGTGATGCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008536
VALIDATED
TM4SF1 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-739s1c1
Sequence:CCGGGCTTCCTGTATTTCACTGTAACTCGAGTTACAGTGAAATACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-180s1c1
Sequence:CCGGGCTTTGCTCTACTTTCCTAATCTCGAGATTAGGAAAGTAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-629s1c1
Sequence:CCGGCTTGTGTCTCATTCAAGTAATCTCGAGATTACTTGAATGAGACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-692s1c1
Sequence:CCGGCCAACAGCAATATAACTGCTACTCGAGTAGCAGTTATATTGCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008536.2-428s1c1
Sequence:CCGGCATTGTGGCATCACTGGGTTTCTCGAGAAACCCAGTGATGCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008536.3-1126s21c1
Sequence:CCGGCTTGTGTCTCATTCAAGTAATCTCGAGATTACTTGAATGAGACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008536.3-1236s21c1
Sequence:CCGGGCTTCCTGTATTTCACTGTAACTCGAGTTACAGTGAAATACAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008536.3-677s21c1
Sequence:CCGGGCTTTGCTCTACTTTCCTAATCTCGAGATTAGGAAAGTAGAGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008536.3-925s21c1
Sequence:CCGGCATTGTGGCATCACTGGGTTTCTCGAGAAACCCAGTGATGCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014220
VALIDATED
TM4SF1 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-1156s1c1
Sequence:CCGGGTTTCCCATTCATACACCTATCTCGAGATAGGTGTATGAATGGGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-601s1c1
Sequence:CCGGTGGCTCTTGGTGGAATTGAATCTCGAGATTCAATTCCACCAAGAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014220.x-638s1c1
Sequence:CCGGTCAAGTAATAAATGGAGTGCTCTCGAGAGCACTCCATTTATTACTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-570s1c1
Sequence:CCGGGAATGGAATGTATCTCTGTTTCTCGAGAAACAGAGATACATTCCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-364s1c1
Sequence:CCGGGTGCGATGCTTTCTTCTGTATCTCGAGATACAGAAGAAAGCATCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014220.2-585s21c1
Sequence:GTACCGGAGGACCACTATGTCTTGATTCCTCGAGGAATCAAGACATAGTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-703s21c1
Sequence:CCGGGAATGGAATGTATCTCTGTTTCTCGAGAAACAGAGATACATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-292s21c1
Sequence:CCGGCTGTGCATCGCGGCTAATATTCTCGAGAATATTAGCCGCGATGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-1156s21c1
Sequence:CCGGATAACATTCCAATCACTATTGCTCGAGCAATAGTGATTGGAATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-497s21c1
Sequence:CCGGGTGCGATGCTTTCTTCTGTATCTCGAGATACAGAAGAAAGCATCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-734s21c1
Sequence:CCGGTGGCTCTTGGTGGAATTGAATCTCGAGATTCAATTCCACCAAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014220.2-814s21c1
Sequence:GTACCGGTGCTCTCACCAACAGCAATATCTCGAGATATTGCTGTTGGTGAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014220.2-611s21c1
Sequence:GTACCGGGCCAGTGGAACTACACCTTTGCTCGAGCAAAGGTGTAGTTCCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014220
VALIDATED
TM4SF1 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-1156s1c1
Sequence:CCGGGTTTCCCATTCATACACCTATCTCGAGATAGGTGTATGAATGGGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-601s1c1
Sequence:CCGGTGGCTCTTGGTGGAATTGAATCTCGAGATTCAATTCCACCAAGAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014220.x-638s1c1
Sequence:CCGGTCAAGTAATAAATGGAGTGCTCTCGAGAGCACTCCATTTATTACTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-570s1c1
Sequence:CCGGGAATGGAATGTATCTCTGTTTCTCGAGAAACAGAGATACATTCCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-364s1c1
Sequence:CCGGGTGCGATGCTTTCTTCTGTATCTCGAGATACAGAAGAAAGCATCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014220.2-585s21c1
Sequence:GTACCGGAGGACCACTATGTCTTGATTCCTCGAGGAATCAAGACATAGTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-703s21c1
Sequence:CCGGGAATGGAATGTATCTCTGTTTCTCGAGAAACAGAGATACATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-292s21c1
Sequence:CCGGCTGTGCATCGCGGCTAATATTCTCGAGAATATTAGCCGCGATGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-1156s21c1
Sequence:CCGGATAACATTCCAATCACTATTGCTCGAGCAATAGTGATTGGAATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-497s21c1
Sequence:CCGGGTGCGATGCTTTCTTCTGTATCTCGAGATACAGAAGAAAGCATCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-734s21c1
Sequence:CCGGTGGCTCTTGGTGGAATTGAATCTCGAGATTCAATTCCACCAAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014220.2-814s21c1
Sequence:GTACCGGTGCTCTCACCAACAGCAATATCTCGAGATATTGCTGTTGGTGAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014220.2-611s21c1
Sequence:GTACCGGGCCAGTGGAACTACACCTTTGCTCGAGCAAAGGTGTAGTTCCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014220
VALIDATED
TM4SF1 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000286    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-1156s1c1
Sequence:CCGGGTTTCCCATTCATACACCTATCTCGAGATAGGTGTATGAATGGGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-601s1c1
Sequence:CCGGTGGCTCTTGGTGGAATTGAATCTCGAGATTCAATTCCACCAAGAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014220.x-638s1c1
Sequence:CCGGTCAAGTAATAAATGGAGTGCTCTCGAGAGCACTCCATTTATTACTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-570s1c1
Sequence:CCGGGAATGGAATGTATCTCTGTTTCTCGAGAAACAGAGATACATTCCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014220.x-364s1c1
Sequence:CCGGGTGCGATGCTTTCTTCTGTATCTCGAGATACAGAAGAAAGCATCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014220.2-585s21c1
Sequence:GTACCGGAGGACCACTATGTCTTGATTCCTCGAGGAATCAAGACATAGTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-703s21c1
Sequence:CCGGGAATGGAATGTATCTCTGTTTCTCGAGAAACAGAGATACATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-292s21c1
Sequence:CCGGCTGTGCATCGCGGCTAATATTCTCGAGAATATTAGCCGCGATGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-1156s21c1
Sequence:CCGGATAACATTCCAATCACTATTGCTCGAGCAATAGTGATTGGAATGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-497s21c1
Sequence:CCGGGTGCGATGCTTTCTTCTGTATCTCGAGATACAGAAGAAAGCATCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014220.2-734s21c1
Sequence:CCGGTGGCTCTTGGTGGAATTGAATCTCGAGATTCAATTCCACCAAGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014220.2-814s21c1
Sequence:GTACCGGTGCTCTCACCAACAGCAATATCTCGAGATATTGCTGTTGGTGAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014220.2-611s21c1
Sequence:GTACCGGGCCAGTGGAACTACACCTTTGCTCGAGCAAAGGTGTAGTTCCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks