EMAIL THIS PAGE TO A FRIEND

TM4SF20

transmembrane 4 L six family member 20

Synonyms: PRO994 TCCE518
UniProtKB ID: Q53R12, B2RP42, Q5U609, Q6UWS1, Q9H5X9
Gene ID:
Mouse(66261) transmembrane 4 L six family member 20
Rat(691066) transmembrane 4 L six family member 20
domestic cat(101088018) transmembrane 4 L six family member 20
dog(609780) transmembrane 4 L six family member 20
cow(767902) transmembrane 4 L six family member 20
sheep(101103299) transmembrane 4 L six family member 20
naked mole-rat(101713808) transmembrane 4 L six family member 20
domestic guinea pig(100715905) transmembrane 4 L six family member 20
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024795 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014521 MISSION® esiRNA esiRNA targeting human TM4SF20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024795 Rosetta Predictions human pricing
NM_001109618 Rosetta Predictions rat pricing
NM_025453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220447 predicted 615
2 SASI_Hs01_00220448 predicted 703
3 SASI_Hs01_00220449 predicted 737
4 SASI_Hs01_00220450 predicted 611
5 SASI_Hs01_00220451 predicted 705
6 SASI_Hs01_00220452 predicted 313
7 SASI_Hs01_00220453 predicted 270
8 SASI_Hs01_00220454 predicted 592
9 SASI_Hs01_00220455 predicted 400
10 SASI_Hs02_00357344 predicted 692
11 SASI_Hs01_00220456 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250142 predicted 653
2 SASI_Rn02_00250143 predicted 710
3 SASI_Rn02_00250144 predicted 744
4 SASI_Rn02_00250145 predicted 462
5 SASI_Rn02_00250146 predicted 291
6 SASI_Rn02_00250147 predicted 337
7 SASI_Rn02_00250148 predicted 328
8 SASI_Rn02_00250149 predicted 491
9 SASI_Rn02_00250150 predicted 647
10 SASI_Rn02_00250151 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123102 predicted 367
2 SASI_Mm01_00123103 predicted 365
3 SASI_Mm01_00123104 predicted 1108
4 SASI_Mm01_00123105 predicted 482
5 SASI_Mm01_00123106 predicted 358
6 SASI_Mm01_00123107 predicted 607
7 SASI_Mm01_00123108 predicted 331
8 SASI_Mm02_00328290 predicted 270
9 SASI_Mm01_00123109 predicted 601
10 SASI_Mm01_00123110 predicted 374
11 SASI_Mm01_00123111 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025453
TM4SF20 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 20
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025453.3-1000s21c1
Sequence:CCGGGACTATACAGAGAAGCTAAAGCTCGAGCTTTAGCTTCTCTGTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-700s1c1
Sequence:CCGGGCGACGGAGTCAAATTGTATACTCGAGTATACAATTTGACTCCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-522s1c1
Sequence:CCGGCCATCAATAACATGGTCAGTACTCGAGTACTGACCATGTTATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-598s1c1
Sequence:CCGGCTCAGTATTTATGAGTCTCCTCTCGAGAGGAGACTCATAAATACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-519s1c1
Sequence:CCGGCCACCATCAATAACATGGTCACTCGAGTGACCATGTTATTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025453.1-1184s1c1
Sequence:CCGGGTTACAGAAGTATGTGTCTTACTCGAGTAAGACACATACTTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025453
TM4SF20 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 20
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025453.3-1000s21c1
Sequence:CCGGGACTATACAGAGAAGCTAAAGCTCGAGCTTTAGCTTCTCTGTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-700s1c1
Sequence:CCGGGCGACGGAGTCAAATTGTATACTCGAGTATACAATTTGACTCCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-522s1c1
Sequence:CCGGCCATCAATAACATGGTCAGTACTCGAGTACTGACCATGTTATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-598s1c1
Sequence:CCGGCTCAGTATTTATGAGTCTCCTCTCGAGAGGAGACTCATAAATACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-519s1c1
Sequence:CCGGCCACCATCAATAACATGGTCACTCGAGTGACCATGTTATTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025453.1-1184s1c1
Sequence:CCGGGTTACAGAAGTATGTGTCTTACTCGAGTAAGACACATACTTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025453
TM4SF20 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 20
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442887    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025453.3-1000s21c1
Sequence:CCGGGACTATACAGAGAAGCTAAAGCTCGAGCTTTAGCTTCTCTGTATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-700s1c1
Sequence:CCGGGCGACGGAGTCAAATTGTATACTCGAGTATACAATTTGACTCCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-522s1c1
Sequence:CCGGCCATCAATAACATGGTCAGTACTCGAGTACTGACCATGTTATTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-598s1c1
Sequence:CCGGCTCAGTATTTATGAGTCTCCTCTCGAGAGGAGACTCATAAATACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025453.1-519s1c1
Sequence:CCGGCCACCATCAATAACATGGTCACTCGAGTGACCATGTTATTGATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025453.1-1184s1c1
Sequence:CCGGGTTACAGAAGTATGTGTCTTACTCGAGTAAGACACATACTTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024795
TM4SF20 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 20
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-495s21c1
Sequence:CCGGCCTCCTACTGGTTTCAATAAACTCGAGTTTATTGAAACCAGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-703s21c1
Sequence:CCGGCTAAGCGAAGAAGTCAAATTGCTCGAGCAATTTGACTTCTTCGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-331s21c1
Sequence:CCGGCTCTGTATTGCATGCTGATATCTCGAGATATCAGCATGCAATACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-388s21c1
Sequence:CCGGATTCTCCAAGCAACAGTAATGCTCGAGCATTACTGTTGCTTGGAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024795.3-862s21c1
Sequence:CCGGCTCATATCAGTGGTTGATTTGCTCGAGCAAATCAACCACTGATATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024795.1-1273s1c1
Sequence:CCGGCCTCCTAAAGTGCTGCGATTACTCGAGTAATCGCAGCACTTTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024795.1-830s1c1
Sequence:CCGGCGTAGAAAGCACGTTGTAAATCTCGAGATTTACAACGTGCTTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024795.1-547s1c1
Sequence:CCGGGAGAGCATCTAGTTTCCACTTCTCGAGAAGTGGAAACTAGATGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024795.1-1803s1c1
Sequence:CCGGCCTGAAGGTAATTTCACACAACTCGAGTTGTGTGAAATTACCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024795.1-122s1c1
Sequence:CCGGCCTCTAATTGTCAGCTTAGTTCTCGAGAACTAAGCTGACAATTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024795.1-107s1c1
Sequence:CCGGGTTCTCAATGTGATACCTCTACTCGAGTAGAGGTATCACATTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024795
TM4SF20 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 20
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-495s21c1
Sequence:CCGGCCTCCTACTGGTTTCAATAAACTCGAGTTTATTGAAACCAGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-703s21c1
Sequence:CCGGCTAAGCGAAGAAGTCAAATTGCTCGAGCAATTTGACTTCTTCGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-331s21c1
Sequence:CCGGCTCTGTATTGCATGCTGATATCTCGAGATATCAGCATGCAATACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-388s21c1
Sequence:CCGGATTCTCCAAGCAACAGTAATGCTCGAGCATTACTGTTGCTTGGAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024795.3-862s21c1
Sequence:CCGGCTCATATCAGTGGTTGATTTGCTCGAGCAAATCAACCACTGATATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024795.1-1273s1c1
Sequence:CCGGCCTCCTAAAGTGCTGCGATTACTCGAGTAATCGCAGCACTTTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024795.1-830s1c1
Sequence:CCGGCGTAGAAAGCACGTTGTAAATCTCGAGATTTACAACGTGCTTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024795.1-547s1c1
Sequence:CCGGGAGAGCATCTAGTTTCCACTTCTCGAGAAGTGGAAACTAGATGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024795.1-1803s1c1
Sequence:CCGGCCTGAAGGTAATTTCACACAACTCGAGTTGTGTGAAATTACCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024795.1-122s1c1
Sequence:CCGGCCTCTAATTGTCAGCTTAGTTCTCGAGAACTAAGCTGACAATTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024795.1-107s1c1
Sequence:CCGGGTTCTCAATGTGATACCTCTACTCGAGTAGAGGTATCACATTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024795
TM4SF20 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 20
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-495s21c1
Sequence:CCGGCCTCCTACTGGTTTCAATAAACTCGAGTTTATTGAAACCAGTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-703s21c1
Sequence:CCGGCTAAGCGAAGAAGTCAAATTGCTCGAGCAATTTGACTTCTTCGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-331s21c1
Sequence:CCGGCTCTGTATTGCATGCTGATATCTCGAGATATCAGCATGCAATACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024795.3-388s21c1
Sequence:CCGGATTCTCCAAGCAACAGTAATGCTCGAGCATTACTGTTGCTTGGAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024795.3-862s21c1
Sequence:CCGGCTCATATCAGTGGTTGATTTGCTCGAGCAAATCAACCACTGATATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024795.1-1273s1c1
Sequence:CCGGCCTCCTAAAGTGCTGCGATTACTCGAGTAATCGCAGCACTTTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159576    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024795.1-830s1c1
Sequence:CCGGCGTAGAAAGCACGTTGTAAATCTCGAGATTTACAACGTGCTTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024795.1-547s1c1
Sequence:CCGGGAGAGCATCTAGTTTCCACTTCTCGAGAAGTGGAAACTAGATGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158531    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024795.1-1803s1c1
Sequence:CCGGCCTGAAGGTAATTTCACACAACTCGAGTTGTGTGAAATTACCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024795.1-122s1c1
Sequence:CCGGCCTCTAATTGTCAGCTTAGTTCTCGAGAACTAAGCTGACAATTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024795.1-107s1c1
Sequence:CCGGGTTCTCAATGTGATACCTCTACTCGAGTAGAGGTATCACATTGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks