EMAIL THIS PAGE TO A FRIEND

TM4SF4

transmembrane 4 L six family member 4

Synonyms: ILTMP il-TMP
UniProtKB ID: P48230, B2RDA4
Gene ID:
Human(7104) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that can regulate cell proliferation.[provided by RefSeq, Mar 2011]
Mouse(229302) transmembrane 4 superfamily member 4
Rat(116467) transmembrane 4 L six family member 4
domestic guinea pig(100717589) transmembrane 4 L six family member 4
naked mole-rat(101721869) transmembrane 4 L six family member 4
cow(507646) transmembrane 4 L six family member 4
sheep(101121226) transmembrane 4 L six family member 4
Zebrafish(445095) transmembrane 4 L six family member 4
domestic cat(101100661) transmembrane 4 L six family member 4
dog(611654) transmembrane 4 L six family member 4
chicken(771806) transmembrane 4 L six family member 4
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004617 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004617 Rosetta Predictions human pricing
NM_053785 Rosetta Predictions rat pricing
NM_145539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222072 predicted 491
2 SASI_Hs01_00222073 predicted 504
3 SASI_Hs01_00222074 predicted 578
4 SASI_Hs01_00222075 predicted 823
5 SASI_Hs01_00222076 predicted 927
6 SASI_Hs01_00222077 predicted 976
7 SASI_Hs01_00222078 predicted 577
8 SASI_Hs01_00222079 predicted 673
9 SASI_Hs01_00222080 predicted 561
10 SASI_Hs01_00222081 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115947 predicted 1183
2 SASI_Rn02_00266591 predicted 681
3 SASI_Rn02_00266592 predicted 726
4 SASI_Rn01_00115948 predicted 664
5 SASI_Rn01_00115949 predicted 400
6 SASI_Rn01_00115950 predicted 1076
7 SASI_Rn01_00115951 predicted 1108
8 SASI_Rn01_00115952 predicted 1160
9 SASI_Rn01_00115953 predicted 935
10 SASI_Rn01_00115954 predicted 644
11 SASI_Rn01_00115955 predicted 440
12 SASI_Rn01_00115956 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130760 predicted 546
2 SASI_Mm01_00130761 predicted 423
3 SASI_Mm01_00130762 predicted 569
4 SASI_Mm01_00130763 predicted 506
5 SASI_Mm01_00130764 predicted 222
6 SASI_Mm01_00130765 predicted 539
7 SASI_Mm01_00130766 predicted 453
8 SASI_Mm01_00130767 predicted 486
9 SASI_Mm01_00130768 predicted 307
10 SASI_Mm01_00130769 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004617
VALIDATED
TM4SF4 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004617.2-939s1c1
Sequence:CCGGCCTAGCTGATAAAGCTTAGAACTCGAGTTCTAAGCTTTATCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004617.2-562s1c1
Sequence:CCGGGCCATTTCAATCAACAAGGGTCTCGAGACCCTTGTTGATTGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004617.2-679s1c1
Sequence:CCGGCTCAATGTGGTTCCCTGGAATCTCGAGATTCCAGGGAACCACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004617.2-537s1c1
Sequence:CCGGAGCTGGATACTCGTTTATCATCTCGAGATGATAAACGAGTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004617.2-1162s1c1
Sequence:CCGGGCCATACTACTTCTTTGTATACTCGAGTATACAAAGAAGTAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004617.2-297s1c1
Sequence:CCGGCCTGGCTAACATCCTGTTATTCTCGAGAATAACAGGATGTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004617.2-930s21c1
Sequence:GTACCGGTATCTGCTTCCTAGCTGATAACTCGAGTTATCAGCTAGGAAGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004617.2-822s21c1
Sequence:GTACCGGGGGAGATGGACCCGTTTAAACCTCGAGGTTTAAACGGGTCCATCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-297s21c1
Sequence:CCGGCCTGGCTAACATCCTGTTATTCTCGAGAATAACAGGATGTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-537s21c1
Sequence:CCGGAGCTGGATACTCGTTTATCATCTCGAGATGATAAACGAGTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-1162s21c1
Sequence:CCGGGCCATACTACTTCTTTGTATACTCGAGTATACAAAGAAGTAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-679s21c1
Sequence:CCGGCTCAATGTGGTTCCCTGGAATCTCGAGATTCCAGGGAACCACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-562s21c1
Sequence:CCGGGCCATTTCAATCAACAAGGGTCTCGAGACCCTTGTTGATTGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004617
VALIDATED
TM4SF4 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004617.2-939s1c1
Sequence:CCGGCCTAGCTGATAAAGCTTAGAACTCGAGTTCTAAGCTTTATCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004617.2-562s1c1
Sequence:CCGGGCCATTTCAATCAACAAGGGTCTCGAGACCCTTGTTGATTGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004617.2-679s1c1
Sequence:CCGGCTCAATGTGGTTCCCTGGAATCTCGAGATTCCAGGGAACCACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004617.2-537s1c1
Sequence:CCGGAGCTGGATACTCGTTTATCATCTCGAGATGATAAACGAGTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004617.2-1162s1c1
Sequence:CCGGGCCATACTACTTCTTTGTATACTCGAGTATACAAAGAAGTAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004617.2-297s1c1
Sequence:CCGGCCTGGCTAACATCCTGTTATTCTCGAGAATAACAGGATGTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004617.2-930s21c1
Sequence:GTACCGGTATCTGCTTCCTAGCTGATAACTCGAGTTATCAGCTAGGAAGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004617.2-822s21c1
Sequence:GTACCGGGGGAGATGGACCCGTTTAAACCTCGAGGTTTAAACGGGTCCATCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-297s21c1
Sequence:CCGGCCTGGCTAACATCCTGTTATTCTCGAGAATAACAGGATGTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-537s21c1
Sequence:CCGGAGCTGGATACTCGTTTATCATCTCGAGATGATAAACGAGTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-1162s21c1
Sequence:CCGGGCCATACTACTTCTTTGTATACTCGAGTATACAAAGAAGTAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-679s21c1
Sequence:CCGGCTCAATGTGGTTCCCTGGAATCTCGAGATTCCAGGGAACCACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-562s21c1
Sequence:CCGGGCCATTTCAATCAACAAGGGTCTCGAGACCCTTGTTGATTGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004617
VALIDATED
TM4SF4 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121542    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004617.2-939s1c1
Sequence:CCGGCCTAGCTGATAAAGCTTAGAACTCGAGTTCTAAGCTTTATCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004617.2-562s1c1
Sequence:CCGGGCCATTTCAATCAACAAGGGTCTCGAGACCCTTGTTGATTGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004617.2-679s1c1
Sequence:CCGGCTCAATGTGGTTCCCTGGAATCTCGAGATTCCAGGGAACCACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004617.2-537s1c1
Sequence:CCGGAGCTGGATACTCGTTTATCATCTCGAGATGATAAACGAGTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004617.2-1162s1c1
Sequence:CCGGGCCATACTACTTCTTTGTATACTCGAGTATACAAAGAAGTAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004617.2-297s1c1
Sequence:CCGGCCTGGCTAACATCCTGTTATTCTCGAGAATAACAGGATGTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004617.2-930s21c1
Sequence:GTACCGGTATCTGCTTCCTAGCTGATAACTCGAGTTATCAGCTAGGAAGCAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004617.2-822s21c1
Sequence:GTACCGGGGGAGATGGACCCGTTTAAACCTCGAGGTTTAAACGGGTCCATCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-297s21c1
Sequence:CCGGCCTGGCTAACATCCTGTTATTCTCGAGAATAACAGGATGTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-537s21c1
Sequence:CCGGAGCTGGATACTCGTTTATCATCTCGAGATGATAAACGAGTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-1162s21c1
Sequence:CCGGGCCATACTACTTCTTTGTATACTCGAGTATACAAAGAAGTAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-679s21c1
Sequence:CCGGCTCAATGTGGTTCCCTGGAATCTCGAGATTCCAGGGAACCACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004617.2-562s21c1
Sequence:CCGGGCCATTTCAATCAACAAGGGTCTCGAGACCCTTGTTGATTGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145539
TM4SF4 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145539.1-1090s1c1
Sequence:CCGGGCCATATTGTCTCTTTGTATACTCGAGTATACAAAGAGACAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-493s1c1
Sequence:CCGGTCTATCAACAAGGGTCCTAAACTCGAGTTTAGGACCCTTGTTGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-549s1c1
Sequence:CCGGCCACGATGGTGATTATCTAAACTCGAGTTTAGATAATCACCATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-430s1c1
Sequence:CCGGTCCACGTTGTTTGCTGTGATTCTCGAGAATCACAGCAAACAACGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-292s1c1
Sequence:CCGGGTCTGGTACTTCGGAGGAATACTCGAGTATTCCTCCGAAGTACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145539.1-295s21c1
Sequence:GTACCGGTGGTACTTCGGAGGAATATTGCTCGAGCAATATTCCTCCGAAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145539.1-213s21c1
Sequence:GTACCGGGTTTGGCCTCCTGGCAAATATCTCGAGATATTTGCCAGGAGGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145539
TM4SF4 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145539.1-1090s1c1
Sequence:CCGGGCCATATTGTCTCTTTGTATACTCGAGTATACAAAGAGACAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-493s1c1
Sequence:CCGGTCTATCAACAAGGGTCCTAAACTCGAGTTTAGGACCCTTGTTGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-549s1c1
Sequence:CCGGCCACGATGGTGATTATCTAAACTCGAGTTTAGATAATCACCATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-430s1c1
Sequence:CCGGTCCACGTTGTTTGCTGTGATTCTCGAGAATCACAGCAAACAACGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-292s1c1
Sequence:CCGGGTCTGGTACTTCGGAGGAATACTCGAGTATTCCTCCGAAGTACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145539.1-295s21c1
Sequence:GTACCGGTGGTACTTCGGAGGAATATTGCTCGAGCAATATTCCTCCGAAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145539.1-213s21c1
Sequence:GTACCGGGTTTGGCCTCCTGGCAAATATCTCGAGATATTTGCCAGGAGGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145539
TM4SF4 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145539.1-1090s1c1
Sequence:CCGGGCCATATTGTCTCTTTGTATACTCGAGTATACAAAGAGACAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-493s1c1
Sequence:CCGGTCTATCAACAAGGGTCCTAAACTCGAGTTTAGGACCCTTGTTGATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-549s1c1
Sequence:CCGGCCACGATGGTGATTATCTAAACTCGAGTTTAGATAATCACCATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-430s1c1
Sequence:CCGGTCCACGTTGTTTGCTGTGATTCTCGAGAATCACAGCAAACAACGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145539.1-292s1c1
Sequence:CCGGGTCTGGTACTTCGGAGGAATACTCGAGTATTCCTCCGAAGTACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145539.1-295s21c1
Sequence:GTACCGGTGGTACTTCGGAGGAATATTGCTCGAGCAATATTCCTCCGAAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145539.1-213s21c1
Sequence:GTACCGGGTTTGGCCTCCTGGCAAATATCTCGAGATATTTGCCAGGAGGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks