EMAIL THIS PAGE TO A FRIEND

TM4SF5

transmembrane 4 L six family member 5

UniProtKB ID: O14894, Q17RW9, Q6IB79
Gene ID:
Human(9032) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is highly similar in sequence and structure to transmembrane 4 superfamily member 1. It may play a role in cell proliferation, and overexpression of this protein may be associated with the uncontrolled growth of tumour cells. [provided by RefSeq, Jul 2008]
Mouse(75604) transmembrane 4 superfamily member 5
Rat(303256) transmembrane 4 L six family member 5
Zebrafish(436645) transmembrane 4 L six family member 5
dog(479474) transmembrane 4 L six family member 5
domestic cat(101093060) transmembrane 4 L six family member 5
cow(511869) transmembrane 4 L six family member 5
sheep(101111205) transmembrane 4 L six family member 5
naked mole-rat(101722828) transmembrane 4 L six family member 5
domestic guinea pig(100716436) transmembrane 4 L six family member 5
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119961 MISSION® esiRNA esiRNA human TM4SF5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003963 Rosetta Predictions human pricing
NM_001107015 Rosetta Predictions rat pricing
NM_029360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211196 predicted 416
2 SASI_Hs01_00211197 predicted 367
3 SASI_Hs01_00211198 predicted 421
4 SASI_Hs01_00211199 predicted 368
5 SASI_Hs01_00211200 predicted 421
6 SASI_Hs01_00211201 predicted 365
7 SASI_Hs01_00211202 predicted 328
8 SASI_Hs01_00211203 predicted 417
9 SASI_Hs01_00211204 predicted 439
10 SASI_Hs01_00211205 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224646 predicted 444
2 SASI_Rn02_00224647 predicted 487
3 SASI_Rn02_00224648 predicted 420
4 SASI_Rn02_00224649 predicted 411
5 SASI_Rn02_00224650 predicted 466
6 SASI_Rn02_00224651 predicted 459
7 SASI_Rn02_00224652 predicted 415
8 SASI_Rn02_00224653 predicted 334
9 SASI_Rn02_00224654 predicted 297
10 SASI_Rn02_00224655 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153648 predicted 441
2 SASI_Mm01_00153649 predicted 387
3 SASI_Mm01_00153650 predicted 388
4 SASI_Mm01_00153651 predicted 391
5 SASI_Mm02_00335223 predicted 461
6 SASI_Mm01_00153652 predicted 459
7 SASI_Mm01_00153653 predicted 487
8 SASI_Mm01_00153654 predicted 381
9 SASI_Mm01_00153655 predicted 420
10 SASI_Mm01_00153657 predicted 418
11 SASI_Mm01_00153656 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003963
TM4SF5 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-154s21c1
Sequence:CCGGCCATCTCAGCTTGCAAGTCTGCTCGAGCAGACTTGCAAGCTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-327s21c1
Sequence:CCGGTTGGTGCCATCTACTGCCTCTCTCGAGAGAGGCAGTAGATGGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-526s21c1
Sequence:CCGGCTCCTGCCTGGAGATAGTACTCTCGAGAGTACTATCTCCAGGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-436s21c1
Sequence:CCGGCTTGCTCAACCGCACTCTATGCTCGAGCATAGAGTGCGGTTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003963.2-538s1c1
Sequence:CCGGGATAGTACTGTGTGGGATCCACTCGAGTGGATCCCACACAGTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003963.2-145s1c1
Sequence:CCGGCAACACCAACCATCTCAGCTTCTCGAGAAGCTGAGATGGTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003963.2-368s1c1
Sequence:CCGGCGAAATGGACCCAGATGCTTACTCGAGTAAGCATCTGGGTCCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003963
TM4SF5 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-154s21c1
Sequence:CCGGCCATCTCAGCTTGCAAGTCTGCTCGAGCAGACTTGCAAGCTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-327s21c1
Sequence:CCGGTTGGTGCCATCTACTGCCTCTCTCGAGAGAGGCAGTAGATGGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-526s21c1
Sequence:CCGGCTCCTGCCTGGAGATAGTACTCTCGAGAGTACTATCTCCAGGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-436s21c1
Sequence:CCGGCTTGCTCAACCGCACTCTATGCTCGAGCATAGAGTGCGGTTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003963.2-538s1c1
Sequence:CCGGGATAGTACTGTGTGGGATCCACTCGAGTGGATCCCACACAGTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003963.2-145s1c1
Sequence:CCGGCAACACCAACCATCTCAGCTTCTCGAGAAGCTGAGATGGTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003963.2-368s1c1
Sequence:CCGGCGAAATGGACCCAGATGCTTACTCGAGTAAGCATCTGGGTCCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003963
TM4SF5 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-154s21c1
Sequence:CCGGCCATCTCAGCTTGCAAGTCTGCTCGAGCAGACTTGCAAGCTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-327s21c1
Sequence:CCGGTTGGTGCCATCTACTGCCTCTCTCGAGAGAGGCAGTAGATGGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-526s21c1
Sequence:CCGGCTCCTGCCTGGAGATAGTACTCTCGAGAGTACTATCTCCAGGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003963.2-436s21c1
Sequence:CCGGCTTGCTCAACCGCACTCTATGCTCGAGCATAGAGTGCGGTTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003963.2-538s1c1
Sequence:CCGGGATAGTACTGTGTGGGATCCACTCGAGTGGATCCCACACAGTACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003963.2-145s1c1
Sequence:CCGGCAACACCAACCATCTCAGCTTCTCGAGAAGCTGAGATGGTTGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003963.2-368s1c1
Sequence:CCGGCGAAATGGACCCAGATGCTTACTCGAGTAAGCATCTGGGTCCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029360
TM4SF5 MISSION shRNA Bacterial Glycerol Stock
transmembrane 4 L six family member 5
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029360.1-542s1c1
Sequence:CCGGGTCGCATCAAGTCTGGAACTTCTCGAGAAGTTCCAGACTTGATGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029360.1-399s1c1
Sequence:CCGGCCAAATGCTTAATAGACAACACTCGAGTGTTGTCTATTAAGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029360.1-586s1c1
Sequence:CCGGGAATGCGACCTTTGGTGTGTTCTCGAGAACACACCAAAGGTCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029360.1-446s1c1
Sequence:CCGGGAAGGCGCTTACTTGCGAAATCTCGAGATTTCGCAAGTAAGCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029360.1-799s1c1
Sequence:CCGGGTTCTGGTTTAGCCTTTGGAACTCGAGTTCCAAAGGCTAAACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029360.1-389s1c1
Sequence:CCGGCGAATTGGACCCAAATGCTTACTCGAGTAAGCATTTGGGTCCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029360
TM4SF5 MISSION shRNA shRNA Plasmid DNA
transmembrane 4 L six family member 5
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029360.1-542s1c1
Sequence:CCGGGTCGCATCAAGTCTGGAACTTCTCGAGAAGTTCCAGACTTGATGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029360.1-399s1c1
Sequence:CCGGCCAAATGCTTAATAGACAACACTCGAGTGTTGTCTATTAAGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029360.1-586s1c1
Sequence:CCGGGAATGCGACCTTTGGTGTGTTCTCGAGAACACACCAAAGGTCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029360.1-446s1c1
Sequence:CCGGGAAGGCGCTTACTTGCGAAATCTCGAGATTTCGCAAGTAAGCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029360.1-799s1c1
Sequence:CCGGGTTCTGGTTTAGCCTTTGGAACTCGAGTTCCAAAGGCTAAACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029360.1-389s1c1
Sequence:CCGGCGAATTGGACCCAAATGCTTACTCGAGTAAGCATTTGGGTCCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029360
TM4SF5 MISSION shRNA Lentiviral Transduction Particles
transmembrane 4 L six family member 5
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029360.1-542s1c1
Sequence:CCGGGTCGCATCAAGTCTGGAACTTCTCGAGAAGTTCCAGACTTGATGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029360.1-399s1c1
Sequence:CCGGCCAAATGCTTAATAGACAACACTCGAGTGTTGTCTATTAAGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029360.1-586s1c1
Sequence:CCGGGAATGCGACCTTTGGTGTGTTCTCGAGAACACACCAAAGGTCGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029360.1-446s1c1
Sequence:CCGGGAAGGCGCTTACTTGCGAAATCTCGAGATTTCGCAAGTAAGCGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029360.1-799s1c1
Sequence:CCGGGTTCTGGTTTAGCCTTTGGAACTCGAGTTCCAAAGGCTAAACCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029360.1-389s1c1
Sequence:CCGGCGAATTGGACCCAAATGCTTACTCGAGTAAGCATTTGGGTCCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks