EMAIL THIS PAGE TO A FRIEND

TM6SF1

transmembrane 6 superfamily member 1

UniProtKB ID: Q9BZW5, A8K7T5, H3BU56, Q4U0U5
Gene ID:
Mouse(107769) transmembrane 6 superfamily member 1
Rat(361600) transmembrane 6 superfamily member 1
domestic guinea pig(100729837) transmembrane 6 superfamily member 1
naked mole-rat(101707010) transmembrane 6 superfamily member 1
cow(616003) transmembrane 6 superfamily member 1
sheep(101111579) transmembrane 6 superfamily member 1
chicken(415462) transmembrane 6 superfamily member 1
domestic cat(101096654) transmembrane 6 superfamily member 1
dog(479058) transmembrane 6 superfamily member 1
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023003 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023003 Rosetta Predictions human pricing
NM_001108490 Rosetta Predictions rat pricing
NM_145375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059616 predicted 1066
2 SASI_Hs01_00059617 predicted 452
3 SASI_Hs01_00059618 predicted 513
4 SASI_Hs01_00059619 predicted 850
5 SASI_Hs01_00059620 predicted 539
6 SASI_Hs01_00059621 predicted 396
7 SASI_Hs01_00059622 predicted 1007
8 SASI_Hs01_00059623 predicted 790
9 SASI_Hs01_00059624 predicted 607
10 SASI_Hs02_00356263 predicted 466
11 SASI_Hs01_00059625 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239159 predicted 327
2 SASI_Rn02_00239160 predicted 528
3 SASI_Rn02_00239161 predicted 758
4 SASI_Rn02_00239162 predicted 957
5 SASI_Rn02_00239163 predicted 1302
6 SASI_Rn02_00239164 predicted 722
7 SASI_Rn02_00239165 predicted 1327
8 SASI_Rn02_00239166 predicted 776
9 SASI_Rn02_00239167 predicted 968
10 SASI_Rn02_00239168 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039757 predicted 1484
2 SASI_Mm01_00039758 predicted 1200
3 SASI_Mm02_00340663 predicted 1310
4 SASI_Mm01_00039759 predicted 1379
5 SASI_Mm02_00340664 predicted 1061
6 SASI_Mm01_00039761 predicted 907
7 SASI_Mm01_00039762 predicted 1265
8 SASI_Mm01_00039763 predicted 1239
9 SASI_Mm01_00039764 predicted 1158
10 SASI_Mm02_00340665 predicted 1592
11 SASI_Mm01_00039755 predicted 1424
12 SASI_Mm01_00039756 predicted 1356
13 SASI_Mm01_00039760 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023003
TM6SF1 MISSION shRNA Bacterial Glycerol Stock
transmembrane 6 superfamily member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-358s1c1
Sequence:CCGGCCGTATCTGAACACCGCATATCTCGAGATATGCGGTGTTCAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023003.1-404s1c1
Sequence:CCGGGCTCTGCTCATTATCTGATGTCTCGAGACATCAGATAATGAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-792s1c1
Sequence:CCGGCTGCCGATTATATACGCAATTCTCGAGAATTGCGTATATAATCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133980    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023003.1-1238s1c1
Sequence:CCGGCCATTTCACTCTCTTCTCATACTCGAGTATGAGAAGAGAGTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-652s1c1
Sequence:CCGGCCCTCAAAGGTTATTCAAGAACTCGAGTTCTTGAATAACCTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-241s1c1
Sequence:CCGGCCACTGTTCTATGTGTATGCACTCGAGTGCATACACATAGAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023003.1-548s1c1
Sequence:CCGGGAACACGAATTTGCCCTGCTTCTCGAGAAGCAGGGCAAATTCGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-911s1c1
Sequence:CCGGGCTTAGTGGTTCCTGGATGTTCTCGAGAACATCCAGGAACCACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023003.3-592s21c1
Sequence:CCGGGAAGTATGGAACACGAATTTGCTCGAGCAAATTCGTGTTCCATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023003.3-1346s21c1
Sequence:CCGGCACTGTATGTGTGAGCTATATCTCGAGATATAGCTCACACATACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023003
TM6SF1 MISSION shRNA shRNA Plasmid DNA
transmembrane 6 superfamily member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-358s1c1
Sequence:CCGGCCGTATCTGAACACCGCATATCTCGAGATATGCGGTGTTCAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023003.1-404s1c1
Sequence:CCGGGCTCTGCTCATTATCTGATGTCTCGAGACATCAGATAATGAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-792s1c1
Sequence:CCGGCTGCCGATTATATACGCAATTCTCGAGAATTGCGTATATAATCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133980    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023003.1-1238s1c1
Sequence:CCGGCCATTTCACTCTCTTCTCATACTCGAGTATGAGAAGAGAGTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-652s1c1
Sequence:CCGGCCCTCAAAGGTTATTCAAGAACTCGAGTTCTTGAATAACCTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-241s1c1
Sequence:CCGGCCACTGTTCTATGTGTATGCACTCGAGTGCATACACATAGAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023003.1-548s1c1
Sequence:CCGGGAACACGAATTTGCCCTGCTTCTCGAGAAGCAGGGCAAATTCGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-911s1c1
Sequence:CCGGGCTTAGTGGTTCCTGGATGTTCTCGAGAACATCCAGGAACCACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023003.3-592s21c1
Sequence:CCGGGAAGTATGGAACACGAATTTGCTCGAGCAAATTCGTGTTCCATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023003.3-1346s21c1
Sequence:CCGGCACTGTATGTGTGAGCTATATCTCGAGATATAGCTCACACATACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023003
TM6SF1 MISSION shRNA Lentiviral Transduction Particles
transmembrane 6 superfamily member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-358s1c1
Sequence:CCGGCCGTATCTGAACACCGCATATCTCGAGATATGCGGTGTTCAGATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023003.1-404s1c1
Sequence:CCGGGCTCTGCTCATTATCTGATGTCTCGAGACATCAGATAATGAGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-792s1c1
Sequence:CCGGCTGCCGATTATATACGCAATTCTCGAGAATTGCGTATATAATCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133980    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023003.1-1238s1c1
Sequence:CCGGCCATTTCACTCTCTTCTCATACTCGAGTATGAGAAGAGAGTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-652s1c1
Sequence:CCGGCCCTCAAAGGTTATTCAAGAACTCGAGTTCTTGAATAACCTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-241s1c1
Sequence:CCGGCCACTGTTCTATGTGTATGCACTCGAGTGCATACACATAGAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023003.1-548s1c1
Sequence:CCGGGAACACGAATTTGCCCTGCTTCTCGAGAAGCAGGGCAAATTCGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023003.1-911s1c1
Sequence:CCGGGCTTAGTGGTTCCTGGATGTTCTCGAGAACATCCAGGAACCACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023003.3-592s21c1
Sequence:CCGGGAAGTATGGAACACGAATTTGCTCGAGCAAATTCGTGTTCCATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023003.3-1346s21c1
Sequence:CCGGCACTGTATGTGTGAGCTATATCTCGAGATATAGCTCACACATACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145375
TM6SF1 MISSION shRNA Bacterial Glycerol Stock
transmembrane 6 superfamily member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145375.1-1541s1c1
Sequence:CCGGGCAGCATACATGTGAGTGAAACTCGAGTTTCACTCACATGTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-795s1c1
Sequence:CCGGGCCTGGAAACATCGTAGGAAACTCGAGTTTCCTACGATGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-1159s1c1
Sequence:CCGGCCTTACTTTGTGATTGCCCTTCTCGAGAAGGGCAATCACAAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-1213s1c1
Sequence:CCGGCCTGATATAACGCTGGTCCATCTCGAGATGGACCAGCGTTATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-1108s1c1
Sequence:CCGGCCTGCTGCTTATCCTAAGATTCTCGAGAATCTTAGGATAAGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145375
TM6SF1 MISSION shRNA shRNA Plasmid DNA
transmembrane 6 superfamily member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145375.1-1541s1c1
Sequence:CCGGGCAGCATACATGTGAGTGAAACTCGAGTTTCACTCACATGTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-795s1c1
Sequence:CCGGGCCTGGAAACATCGTAGGAAACTCGAGTTTCCTACGATGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-1159s1c1
Sequence:CCGGCCTTACTTTGTGATTGCCCTTCTCGAGAAGGGCAATCACAAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-1213s1c1
Sequence:CCGGCCTGATATAACGCTGGTCCATCTCGAGATGGACCAGCGTTATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-1108s1c1
Sequence:CCGGCCTGCTGCTTATCCTAAGATTCTCGAGAATCTTAGGATAAGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145375
TM6SF1 MISSION shRNA Lentiviral Transduction Particles
transmembrane 6 superfamily member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145375.1-1541s1c1
Sequence:CCGGGCAGCATACATGTGAGTGAAACTCGAGTTTCACTCACATGTATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-795s1c1
Sequence:CCGGGCCTGGAAACATCGTAGGAAACTCGAGTTTCCTACGATGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-1159s1c1
Sequence:CCGGCCTTACTTTGTGATTGCCCTTCTCGAGAAGGGCAATCACAAAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-1213s1c1
Sequence:CCGGCCTGATATAACGCTGGTCCATCTCGAGATGGACCAGCGTTATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145375.1-1108s1c1
Sequence:CCGGCCTGCTGCTTATCCTAAGATTCTCGAGAATCTTAGGATAAGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks