EMAIL THIS PAGE TO A FRIEND

TM6SF2

transmembrane 6 superfamily member 2

UniProtKB ID: Q9BZW4, Q0IJ64
Gene ID:
Mouse(107770) transmembrane 6 superfamily member 2
Rat(689029) transmembrane 6 superfamily member 2
Zebrafish(791179) transmembrane 6 superfamily member 2
Horse(100069679) transmembrane 6 superfamily member 2
dog(609715) transmembrane 6 superfamily member 2
domestic cat(101098934) transmembrane 6 superfamily member 2
chicken(425719) transmembrane 6 superfamily member 2
cow(515889) transmembrane 6 superfamily member 2
sheep(101105326) transmembrane 6 superfamily member 2
naked mole-rat(101715377) transmembrane 6 superfamily member 2
domestic guinea pig(100721686) transmembrane 6 superfamily member 2
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001524 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001524 Rosetta Predictions human pricing
NM_203510 Rosetta Predictions human pricing
NM_001127654 Rosetta Predictions rat pricing
NM_181540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099772 predicted 852
2 SASI_Hs01_00099773 predicted 842
3 SASI_Hs02_00303814 predicted 1043
4 SASI_Hs01_00099774 predicted 540
5 SASI_Hs01_00099775 predicted 1118
6 SASI_Hs02_00303815 predicted 1210
7 SASI_Hs01_00099776 predicted 495
8 SASI_Hs01_00099777 predicted 897
9 SASI_Hs01_00099778 predicted 838
10 SASI_Hs02_00303816 predicted 1208
11 SASI_Hs01_00099779 predicted 941
12 SASI_Hs01_00099780 predicted 547
13 SASI_Hs01_00099781 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135854 predicted 554
2 SASI_Hs01_00135855 predicted 740
3 SASI_Hs01_00135856 predicted 323
4 SASI_Hs01_00135857 predicted 833
5 SASI_Hs01_00135858 predicted 968
6 SASI_Hs01_00135859 predicted 913
7 SASI_Hs01_00135860 predicted 668
8 SASI_Hs01_00135861 predicted 1189
9 SASI_Hs01_00135862 predicted 953
10 SASI_Hs01_00135863 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254780 predicted 611
2 SASI_Rn02_00254781 predicted 458
3 SASI_Rn02_00254782 predicted 546
4 SASI_Rn02_00254783 predicted 267
5 SASI_Rn02_00254784 predicted 474
6 SASI_Rn02_00254785 predicted 199
7 SASI_Rn02_00254786 predicted 502
8 SASI_Rn02_00254787 predicted 562
9 SASI_Rn02_00254788 predicted 755
10 SASI_Rn02_00254789 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171764 predicted 529
2 SASI_Mm01_00171765 predicted 202
3 SASI_Mm01_00171766 predicted 713
4 SASI_Mm01_00171767 predicted 865
5 SASI_Mm01_00171768 predicted 556
6 SASI_Mm01_00171769 predicted 319
7 SASI_Mm01_00171770 predicted 716
8 SASI_Mm01_00171771 predicted 1049
9 SASI_Mm01_00171772 predicted 553
10 SASI_Mm02_00349806 predicted 795
11 SASI_Mm01_00171773 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001524
TM6SF2 MISSION shRNA Bacterial Glycerol Stock
transmembrane 6 superfamily member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001524.2-793s21c1
Sequence:CCGGTTGTCTATATCTACCAGTATGCTCGAGCATACTGGTAGATATAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001524.2-1296s21c1
Sequence:CCGGAGTCTTGGCTATGGTAGTTTCCTCGAGGAAACTACCATAGCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001524.2-521s21c1
Sequence:CCGGAGGAAACATTCTTGGCAAATACTCGAGTATTTGCCAAGAATGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001524.2-702s21c1
Sequence:CCGGGACCTGGCCCTTGTCATATATCTCGAGATATATGACAAGGGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001524.1-378s1c1
Sequence:CCGGGTCTTCATCTGCTACTGGGATCTCGAGATCCCAGTAGCAGATGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001524.1-523s1c1
Sequence:CCGGGAAACATTCTTGGCAAATACACTCGAGTGTATTTGCCAAGAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001524
TM6SF2 MISSION shRNA shRNA Plasmid DNA
transmembrane 6 superfamily member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001524.2-793s21c1
Sequence:CCGGTTGTCTATATCTACCAGTATGCTCGAGCATACTGGTAGATATAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001524.2-1296s21c1
Sequence:CCGGAGTCTTGGCTATGGTAGTTTCCTCGAGGAAACTACCATAGCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001524.2-521s21c1
Sequence:CCGGAGGAAACATTCTTGGCAAATACTCGAGTATTTGCCAAGAATGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001524.2-702s21c1
Sequence:CCGGGACCTGGCCCTTGTCATATATCTCGAGATATATGACAAGGGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001524.1-378s1c1
Sequence:CCGGGTCTTCATCTGCTACTGGGATCTCGAGATCCCAGTAGCAGATGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001524.1-523s1c1
Sequence:CCGGGAAACATTCTTGGCAAATACACTCGAGTGTATTTGCCAAGAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001524
TM6SF2 MISSION shRNA Lentiviral Transduction Particles
transmembrane 6 superfamily member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001524.2-793s21c1
Sequence:CCGGTTGTCTATATCTACCAGTATGCTCGAGCATACTGGTAGATATAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001524.2-1296s21c1
Sequence:CCGGAGTCTTGGCTATGGTAGTTTCCTCGAGGAAACTACCATAGCCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001524.2-521s21c1
Sequence:CCGGAGGAAACATTCTTGGCAAATACTCGAGTATTTGCCAAGAATGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001524.2-702s21c1
Sequence:CCGGGACCTGGCCCTTGTCATATATCTCGAGATATATGACAAGGGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001524.1-378s1c1
Sequence:CCGGGTCTTCATCTGCTACTGGGATCTCGAGATCCCAGTAGCAGATGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001524.1-523s1c1
Sequence:CCGGGAAACATTCTTGGCAAATACACTCGAGTGTATTTGCCAAGAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181540
TM6SF2 MISSION shRNA Bacterial Glycerol Stock
transmembrane 6 superfamily member 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-791s1c1
Sequence:CCGGGATGCCTGCTTCATCTATATTCTCGAGAATATAGATGAAGCAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-859s1c1
Sequence:CCGGGCAGATGCTGATGTATTTGTTCTCGAGAACAAATACATCAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-296s1c1
Sequence:CCGGGACCTTGTCATTGCACTCCAACTCGAGTTGGAGTGCAATGACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-862s1c1
Sequence:CCGGGATGCTGATGTATTTGTTCTACTCGAGTAGAACAAATACATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181540.2-313s1c1
Sequence:CCGGCCAAGAAGATGGCTACATGATCTCGAGATCATGTAGCCATCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181540.2-126s1c1
Sequence:CCGGCCTACCTACTCAATCAAGTTTCTCGAGAAACTTGATTGAGTAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181540
TM6SF2 MISSION shRNA shRNA Plasmid DNA
transmembrane 6 superfamily member 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-791s1c1
Sequence:CCGGGATGCCTGCTTCATCTATATTCTCGAGAATATAGATGAAGCAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-859s1c1
Sequence:CCGGGCAGATGCTGATGTATTTGTTCTCGAGAACAAATACATCAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-296s1c1
Sequence:CCGGGACCTTGTCATTGCACTCCAACTCGAGTTGGAGTGCAATGACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-862s1c1
Sequence:CCGGGATGCTGATGTATTTGTTCTACTCGAGTAGAACAAATACATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181540.2-313s1c1
Sequence:CCGGCCAAGAAGATGGCTACATGATCTCGAGATCATGTAGCCATCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181540.2-126s1c1
Sequence:CCGGCCTACCTACTCAATCAAGTTTCTCGAGAAACTTGATTGAGTAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181540
TM6SF2 MISSION shRNA Lentiviral Transduction Particles
transmembrane 6 superfamily member 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-791s1c1
Sequence:CCGGGATGCCTGCTTCATCTATATTCTCGAGAATATAGATGAAGCAGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-859s1c1
Sequence:CCGGGCAGATGCTGATGTATTTGTTCTCGAGAACAAATACATCAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-296s1c1
Sequence:CCGGGACCTTGTCATTGCACTCCAACTCGAGTTGGAGTGCAATGACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181540.2-862s1c1
Sequence:CCGGGATGCTGATGTATTTGTTCTACTCGAGTAGAACAAATACATCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181540.2-313s1c1
Sequence:CCGGCCAAGAAGATGGCTACATGATCTCGAGATCATGTAGCCATCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181540.2-126s1c1
Sequence:CCGGCCTACCTACTCAATCAAGTTTCTCGAGAAACTTGATTGAGTAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks