EMAIL THIS PAGE TO A FRIEND

TM7SF2

transmembrane 7 superfamily member 2

Synonyms: ANG1 DHCR14A NET47
UniProtKB ID: O76062, A8K4H0, O95982, Q8IY06, Q96E64, Q96GZ1
Gene ID:
Mouse(73166) transmembrane 7 superfamily member 2
Rat(293688) transmembrane 7 superfamily member 2
domestic guinea pig(100725462) transmembrane 7 superfamily member 2
naked mole-rat(101699579) transmembrane 7 superfamily member 2
cow(282384) transmembrane 7 superfamily member 2
Goat(100861120) transmembrane 7 superfamily member 2
Zebrafish(494054) transmembrane 7 superfamily member 2
Horse(100056588) transmembrane 7 superfamily member 2
domestic cat(101083545) transmembrane 7 superfamily member 2
dog(476027) transmembrane 7 superfamily member 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003273 Rosetta Predictions human pricing
NM_001013071 Rosetta Predictions rat pricing
NM_028454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208841 predicted 683
2 SASI_Hs01_00208842 predicted 1260
3 SASI_Hs02_00335329 predicted 575
4 SASI_Hs01_00208843 predicted 639
5 SASI_Hs01_00208844 predicted 646
6 SASI_Hs01_00208846 predicted 564
7 SASI_Hs01_00208847 predicted 1021
8 SASI_Hs01_00208848 predicted 871
9 SASI_Hs02_00335330 predicted 701
10 SASI_Hs02_00335331 predicted 1020
11 SASI_Hs01_00208840 predicted 1700
12 SASI_Hs01_00208845 predicted 1461
13 SASI_Hs01_00208849 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093529 predicted 637
2 SASI_Rn01_00093530 predicted 577
3 SASI_Rn01_00093531 predicted 494
4 SASI_Rn01_00093532 predicted 968
5 SASI_Rn01_00093533 predicted 825
6 SASI_Rn01_00093534 predicted 814
7 SASI_Rn01_00093535 predicted 1202
8 SASI_Rn01_00093536 predicted 812
9 SASI_Rn01_00093537 predicted 782
10 SASI_Rn01_00093538 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056665 predicted 676
2 SASI_Mm01_00056670 predicted 539
3 SASI_Mm02_00333894 predicted 1012
4 SASI_Mm02_00333895 predicted 540
5 SASI_Mm01_00056673 predicted 619
6 SASI_Mm01_00056674 predicted 440
7 SASI_Mm02_00333896 predicted 862
8 SASI_Mm02_00333897 predicted 1008
9 SASI_Mm02_00333898 predicted 1242
10 SASI_Mm01_00056669 predicted 1212
11 SASI_Mm01_00056666 predicted 782
12 SASI_Mm01_00056667 predicted 1003
13 SASI_Mm01_00056668 predicted 773
14 SASI_Mm01_00056671 predicted 904
15 SASI_Mm01_00056672 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003273
TM7SF2 MISSION shRNA Bacterial Glycerol Stock
transmembrane 7 superfamily member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-944s1c1
Sequence:CCGGGCGCTATCCTATTAACGGCTTCTCGAGAAGCCGTTAATAGGATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1088s1c1
Sequence:CCGGCAGCCTCTTTCTCTACATGAACTCGAGTTCATGTAGAGAAAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1537s1c1
Sequence:CCGGGCCTCATCAATGCTACTGGTTCTCGAGAACCAGTAGCATTGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1702s1c1
Sequence:CCGGCCAACTATCTTGGAGACCTCACTCGAGTGAGGTCTCCAAGATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1196s1c1
Sequence:CCGGCCCTCGTATCTGTTTCTTCGACTCGAGTCGAAGAAACAGATACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-836s21c1
Sequence:CCGGAGTTGCTCTACGTGGGTGATGCTCGAGCATCACCCACGTAGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-893s21c1
Sequence:CCGGATATCACACATGACGGGTTTGCTCGAGCAAACCCGTCATGTGTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-1377s21c1
Sequence:CCGGTTACCGCATCATGCCCTACATCTCGAGATGTAGGGCATGATGCGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-1087s21c1
Sequence:CCGGTTCCGAAAGAATCCTTCTGACCTCGAGGTCAGAAGGATTCTTTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-639s21c1
Sequence:CCGGGAACTCAGGCAATCCGATTTACTCGAGTAAATCGGATTGCCTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003273
TM7SF2 MISSION shRNA shRNA Plasmid DNA
transmembrane 7 superfamily member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-944s1c1
Sequence:CCGGGCGCTATCCTATTAACGGCTTCTCGAGAAGCCGTTAATAGGATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1088s1c1
Sequence:CCGGCAGCCTCTTTCTCTACATGAACTCGAGTTCATGTAGAGAAAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1537s1c1
Sequence:CCGGGCCTCATCAATGCTACTGGTTCTCGAGAACCAGTAGCATTGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1702s1c1
Sequence:CCGGCCAACTATCTTGGAGACCTCACTCGAGTGAGGTCTCCAAGATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1196s1c1
Sequence:CCGGCCCTCGTATCTGTTTCTTCGACTCGAGTCGAAGAAACAGATACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-836s21c1
Sequence:CCGGAGTTGCTCTACGTGGGTGATGCTCGAGCATCACCCACGTAGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-893s21c1
Sequence:CCGGATATCACACATGACGGGTTTGCTCGAGCAAACCCGTCATGTGTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-1377s21c1
Sequence:CCGGTTACCGCATCATGCCCTACATCTCGAGATGTAGGGCATGATGCGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-1087s21c1
Sequence:CCGGTTCCGAAAGAATCCTTCTGACCTCGAGGTCAGAAGGATTCTTTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-639s21c1
Sequence:CCGGGAACTCAGGCAATCCGATTTACTCGAGTAAATCGGATTGCCTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003273
TM7SF2 MISSION shRNA Lentiviral Transduction Particles
transmembrane 7 superfamily member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-944s1c1
Sequence:CCGGGCGCTATCCTATTAACGGCTTCTCGAGAAGCCGTTAATAGGATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1088s1c1
Sequence:CCGGCAGCCTCTTTCTCTACATGAACTCGAGTTCATGTAGAGAAAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1537s1c1
Sequence:CCGGGCCTCATCAATGCTACTGGTTCTCGAGAACCAGTAGCATTGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1702s1c1
Sequence:CCGGCCAACTATCTTGGAGACCTCACTCGAGTGAGGTCTCCAAGATAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003273.1-1196s1c1
Sequence:CCGGCCCTCGTATCTGTTTCTTCGACTCGAGTCGAAGAAACAGATACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-836s21c1
Sequence:CCGGAGTTGCTCTACGTGGGTGATGCTCGAGCATCACCCACGTAGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-893s21c1
Sequence:CCGGATATCACACATGACGGGTTTGCTCGAGCAAACCCGTCATGTGTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-1377s21c1
Sequence:CCGGTTACCGCATCATGCCCTACATCTCGAGATGTAGGGCATGATGCGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-1087s21c1
Sequence:CCGGTTCCGAAAGAATCCTTCTGACCTCGAGGTCAGAAGGATTCTTTCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003273.2-639s21c1
Sequence:CCGGGAACTCAGGCAATCCGATTTACTCGAGTAAATCGGATTGCCTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028454
VALIDATED
TM7SF2 MISSION shRNA Bacterial Glycerol Stock
transmembrane 7 superfamily member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-1372s1c1
Sequence:CCGGCGTGTGCCTTACCGAATCATACTCGAGTATGATTCGGTAAGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-1275s1c1
Sequence:CCGGCGTCCTCTACTTCACTGCATTCTCGAGAATGCAGTGAAGTAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-854s1c1
Sequence:CCGGCCTCACCACCATGGACATAATCTCGAGATTATGTCCATGGTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028454.1-560s1c1
Sequence:CCGGCCTCCTCTATGCGAAGGCTTTCTCGAGAAAGCCTTCGCATAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-1003s1c1
Sequence:CCGGGCCTCCTTAAGGCTATTGGTTCTCGAGAACCAATAGCCTTAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028454
VALIDATED
TM7SF2 MISSION shRNA shRNA Plasmid DNA
transmembrane 7 superfamily member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-1372s1c1
Sequence:CCGGCGTGTGCCTTACCGAATCATACTCGAGTATGATTCGGTAAGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-1275s1c1
Sequence:CCGGCGTCCTCTACTTCACTGCATTCTCGAGAATGCAGTGAAGTAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-854s1c1
Sequence:CCGGCCTCACCACCATGGACATAATCTCGAGATTATGTCCATGGTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028454.1-560s1c1
Sequence:CCGGCCTCCTCTATGCGAAGGCTTTCTCGAGAAAGCCTTCGCATAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-1003s1c1
Sequence:CCGGGCCTCCTTAAGGCTATTGGTTCTCGAGAACCAATAGCCTTAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028454
VALIDATED
TM7SF2 MISSION shRNA Lentiviral Transduction Particles
transmembrane 7 superfamily member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-1372s1c1
Sequence:CCGGCGTGTGCCTTACCGAATCATACTCGAGTATGATTCGGTAAGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-1275s1c1
Sequence:CCGGCGTCCTCTACTTCACTGCATTCTCGAGAATGCAGTGAAGTAGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-854s1c1
Sequence:CCGGCCTCACCACCATGGACATAATCTCGAGATTATGTCCATGGTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028454.1-560s1c1
Sequence:CCGGCCTCCTCTATGCGAAGGCTTTCTCGAGAAAGCCTTCGCATAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028454.1-1003s1c1
Sequence:CCGGGCCTCCTTAAGGCTATTGGTTCTCGAGAACCAATAGCCTTAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks