EMAIL THIS PAGE TO A FRIEND

TM7SF3

transmembrane 7 superfamily member 3

UniProtKB ID: Q9NS93, B3KMZ3, Q9NUS4
Gene ID:
Mouse(67623) transmembrane 7 superfamily member 3
Rat(297725) transmembrane 7 superfamily member 3
Zebrafish(565343) transmembrane 7 superfamily member 3
Horse(100069046) transmembrane 7 superfamily member 3
domestic cat(101081392) transmembrane 7 superfamily member 3
dog(486625) transmembrane 7 superfamily member 3
chicken(418215) transmembrane 7 superfamily member 3
cow(510190) transmembrane 7 superfamily member 3
sheep(101112302) transmembrane 7 superfamily member 3
naked mole-rat(101713568) transmembrane 7 superfamily member 3
domestic guinea pig(100724379) transmembrane 7 superfamily member 3
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041097 Anti-TM7SF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016551 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049511 MISSION® esiRNA esiRNA human TM7SF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016551 Rosetta Predictions human pricing
NM_001011970 Rosetta Predictions rat pricing
XM_575722 Rosetta Predictions rat pricing
NM_026281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033229 predicted 854
2 SASI_Hs01_00033230 predicted 800
3 SASI_Hs01_00033231 predicted 1051
4 SASI_Hs01_00033232 predicted 1401
5 SASI_Hs01_00033233 predicted 443
6 SASI_Hs01_00033234 predicted 394
7 SASI_Hs01_00033235 predicted 1138
8 SASI_Hs01_00033237 predicted 612
9 SASI_Hs02_00349670 predicted 250
10 SASI_Hs01_00033238 predicted 458
11 SASI_Hs01_00033236 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055444 predicted 1317
2 SASI_Rn01_00055445 predicted 878
3 SASI_Rn01_00055446 predicted 524
4 SASI_Rn01_00055447 predicted 1414
5 SASI_Rn02_00199992 predicted 1573
6 SASI_Rn01_00055449 predicted 517
7 SASI_Rn01_00055450 predicted 463
8 SASI_Rn01_00055451 predicted 1411
9 SASI_Rn01_00055452 predicted 944
10 SASI_Rn01_00055453 predicted 860
11 SASI_Rn01_00055448 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160708 predicted 1315
2 SASI_Rn01_00160709 predicted 877
3 SASI_Rn01_00160710 predicted 526
4 SASI_Rn01_00160711 predicted 1411
5 SASI_Rn01_00160712 predicted 501
6 SASI_Rn01_00160713 predicted 524
7 SASI_Rn01_00160714 predicted 466
8 SASI_Rn01_00160715 predicted 1420
9 SASI_Rn01_00160716 predicted 948
10 SASI_Rn01_00160717 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133091 predicted 291
2 SASI_Mm01_00133092 predicted 530
3 SASI_Mm02_00329971 predicted 1062
4 SASI_Mm01_00133093 predicted 932
5 SASI_Mm02_00329972 predicted 908
6 SASI_Mm01_00133094 predicted 1451
7 SASI_Mm02_00329973 predicted 1613
8 SASI_Mm01_00133096 predicted 532
9 SASI_Mm01_00133099 predicted 1348
10 SASI_Mm02_00329974 predicted 1448
11 SASI_Mm01_00133095 predicted 1017
12 SASI_Mm01_00133097 predicted 856
13 SASI_Mm01_00133098 predicted 1358
14 SASI_Mm01_00133100 predicted 1717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016551
VALIDATED
TM7SF3 MISSION shRNA Bacterial Glycerol Stock
transmembrane 7 superfamily member 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-816s21c1
Sequence:CCGGAGTATGATGTCTATCAGTATTCTCGAGAATACTGATAGACATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-1877s21c1
Sequence:CCGGGGCCGATTAACCCAGATTAAACTCGAGTTTAATCTGGGTTAATCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-318s21c1
Sequence:CCGGATTCCAGCGAGGGTCTTATTGCTCGAGCAATAAGACCCTCGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016551.2-651s21c1
Sequence:CCGGGCTGTAATTTGGAGTTCGATTCTCGAGAATCGAACTCCAAATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-2072s21c1
Sequence:CCGGATGGTGCCCTTATTGATATATCTCGAGATATATCAATAAGGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016551.2-1721s21c1
Sequence:CCGGGCTGTAAGTGGAATTACGTTACTCGAGTAACGTAATTCCACTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-2031s21c1
Sequence:CCGGATAAGAGATCAGGCATATATACTCGAGTATATATGCCTGATCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016551.1-2172s1c1
Sequence:CCGGCTGTGACAGTATTTGGAGATTCTCGAGAATCTCCAAATACTGTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016551.1-450s1c1
Sequence:CCGGGCTGTAATTTGGAGTTCGATTCTCGAGAATCGAACTCCAAATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016551.1-1861s1c1
Sequence:CCGGGCATAATATTATGGTGCCCTTCTCGAGAAGGGCACCATAATATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016551.1-1520s1c1
Sequence:CCGGGCTGTAAGTGGAATTACGTTACTCGAGTAACGTAATTCCACTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016551
VALIDATED
TM7SF3 MISSION shRNA shRNA Plasmid DNA
transmembrane 7 superfamily member 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-816s21c1
Sequence:CCGGAGTATGATGTCTATCAGTATTCTCGAGAATACTGATAGACATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-1877s21c1
Sequence:CCGGGGCCGATTAACCCAGATTAAACTCGAGTTTAATCTGGGTTAATCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-318s21c1
Sequence:CCGGATTCCAGCGAGGGTCTTATTGCTCGAGCAATAAGACCCTCGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016551.2-651s21c1
Sequence:CCGGGCTGTAATTTGGAGTTCGATTCTCGAGAATCGAACTCCAAATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-2072s21c1
Sequence:CCGGATGGTGCCCTTATTGATATATCTCGAGATATATCAATAAGGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016551.2-1721s21c1
Sequence:CCGGGCTGTAAGTGGAATTACGTTACTCGAGTAACGTAATTCCACTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-2031s21c1
Sequence:CCGGATAAGAGATCAGGCATATATACTCGAGTATATATGCCTGATCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016551.1-2172s1c1
Sequence:CCGGCTGTGACAGTATTTGGAGATTCTCGAGAATCTCCAAATACTGTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016551.1-450s1c1
Sequence:CCGGGCTGTAATTTGGAGTTCGATTCTCGAGAATCGAACTCCAAATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016551.1-1861s1c1
Sequence:CCGGGCATAATATTATGGTGCCCTTCTCGAGAAGGGCACCATAATATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016551.1-1520s1c1
Sequence:CCGGGCTGTAAGTGGAATTACGTTACTCGAGTAACGTAATTCCACTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016551
VALIDATED
TM7SF3 MISSION shRNA Lentiviral Transduction Particles
transmembrane 7 superfamily member 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-816s21c1
Sequence:CCGGAGTATGATGTCTATCAGTATTCTCGAGAATACTGATAGACATCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-1877s21c1
Sequence:CCGGGGCCGATTAACCCAGATTAAACTCGAGTTTAATCTGGGTTAATCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-318s21c1
Sequence:CCGGATTCCAGCGAGGGTCTTATTGCTCGAGCAATAAGACCCTCGCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016551.2-651s21c1
Sequence:CCGGGCTGTAATTTGGAGTTCGATTCTCGAGAATCGAACTCCAAATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-2072s21c1
Sequence:CCGGATGGTGCCCTTATTGATATATCTCGAGATATATCAATAAGGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016551.2-1721s21c1
Sequence:CCGGGCTGTAAGTGGAATTACGTTACTCGAGTAACGTAATTCCACTTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016551.2-2031s21c1
Sequence:CCGGATAAGAGATCAGGCATATATACTCGAGTATATATGCCTGATCTCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016551.1-2172s1c1
Sequence:CCGGCTGTGACAGTATTTGGAGATTCTCGAGAATCTCCAAATACTGTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016551.1-450s1c1
Sequence:CCGGGCTGTAATTTGGAGTTCGATTCTCGAGAATCGAACTCCAAATTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016551.1-1861s1c1
Sequence:CCGGGCATAATATTATGGTGCCCTTCTCGAGAAGGGCACCATAATATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016551.1-1520s1c1
Sequence:CCGGGCTGTAAGTGGAATTACGTTACTCGAGTAACGTAATTCCACTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026281
VALIDATED
TM7SF3 MISSION shRNA Bacterial Glycerol Stock
transmembrane 7 superfamily member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-477s1c1
Sequence:CCGGGCTGCAATTTGGAGTTTGATTCTCGAGAATCAAACTCCAAATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-1552s1c1
Sequence:CCGGCAGTGGAATTACACTTCAGATCTCGAGATCTGAAGTGTAATTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-1396s1c1
Sequence:CCGGGTTGGCTGTTAACAGTTACATCTCGAGATGTAACTGTTAACAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-291s1c1
Sequence:CCGGCCACGGTTTCATTTACTAAGACTCGAGTCTTAGTAAATGAAACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-818s1c1
Sequence:CCGGGTCATCTATAATGTCATCGTTCTCGAGAACGATGACATTATAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026281
VALIDATED
TM7SF3 MISSION shRNA shRNA Plasmid DNA
transmembrane 7 superfamily member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-477s1c1
Sequence:CCGGGCTGCAATTTGGAGTTTGATTCTCGAGAATCAAACTCCAAATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-1552s1c1
Sequence:CCGGCAGTGGAATTACACTTCAGATCTCGAGATCTGAAGTGTAATTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-1396s1c1
Sequence:CCGGGTTGGCTGTTAACAGTTACATCTCGAGATGTAACTGTTAACAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-291s1c1
Sequence:CCGGCCACGGTTTCATTTACTAAGACTCGAGTCTTAGTAAATGAAACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-818s1c1
Sequence:CCGGGTCATCTATAATGTCATCGTTCTCGAGAACGATGACATTATAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026281
VALIDATED
TM7SF3 MISSION shRNA Lentiviral Transduction Particles
transmembrane 7 superfamily member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-477s1c1
Sequence:CCGGGCTGCAATTTGGAGTTTGATTCTCGAGAATCAAACTCCAAATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-1552s1c1
Sequence:CCGGCAGTGGAATTACACTTCAGATCTCGAGATCTGAAGTGTAATTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-1396s1c1
Sequence:CCGGGTTGGCTGTTAACAGTTACATCTCGAGATGTAACTGTTAACAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-291s1c1
Sequence:CCGGCCACGGTTTCATTTACTAAGACTCGAGTCTTAGTAAATGAAACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026281.1-818s1c1
Sequence:CCGGGTCATCTATAATGTCATCGTTCTCGAGAACGATGACATTATAGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks