EMAIL THIS PAGE TO A FRIEND

TM9SF1

transmembrane 9 superfamily member 1

Synonyms: HMP70 MP70
UniProtKB ID: O15321, D3DS65, Q86SZ6, Q96FI8
Gene ID:
Mouse(74140) transmembrane 9 superfamily member 1
Rat(361043) transmembrane 9 superfamily member 1
Zebrafish(445156) transmembrane 9 superfamily member 1
Horse(100051449) transmembrane 9 superfamily member 1
domestic cat(101101224) transmembrane 9 superfamily member 1
dog(480261) transmembrane 9 superfamily member 1
Domestic Rabbit(100344682) transmembrane 9 superfamily member 1
naked mole-rat(101726728) transmembrane 9 superfamily member 1
domestic guinea pig(100731862) transmembrane 9 superfamily member 1
cow(539478) transmembrane 9 superfamily member 1
sheep(101116149) transmembrane 9 superfamily member 1
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44683 Anti-TM9SF1 (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, rabbit, guinea pig, canine, zebrafish, mouse, rat, horse, human,
immunohistochemistry, western blot pricing
AV44685 Anti-TM9SF1 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, horse, canine, bovine, human, rat, rabbit
immunohistochemistry, western blot pricing
SAB2102444 Anti-TM9SF1 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, bovine, zebrafish, human, rat, mouse, horse
western blot pricing
HPA059249 Anti-TM9SF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006405 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014842 Rosetta Predictions human pricing
NM_006405 Rosetta Predictions human pricing
NM_001012155 Rosetta Predictions rat pricing
XM_573777 Rosetta Predictions rat pricing
NM_028780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175416 predicted 1129
2 SASI_Hs01_00175417 predicted 544
3 SASI_Hs02_00306593 predicted 496
4 SASI_Hs01_00175419 predicted 512
5 SASI_Hs01_00175420 predicted 395
6 SASI_Hs01_00175421 predicted 613
7 SASI_Hs01_00175422 predicted 841
8 SASI_Hs01_00175423 predicted 1309
9 SASI_Hs01_00175424 predicted 486
10 SASI_Hs01_00175425 predicted 1527
11 SASI_Hs01_00175418 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153185 predicted 1128
2 SASI_Hs01_00153186 predicted 551
3 SASI_Hs02_00341493 predicted 491
4 SASI_Hs01_00153188 predicted 515
5 SASI_Hs01_00153189 predicted 398
6 SASI_Hs01_00153190 predicted 619
7 SASI_Hs01_00153191 predicted 846
8 SASI_Hs01_00153192 predicted 1307
9 SASI_Hs01_00153193 predicted 481
10 SASI_Hs01_00153194 predicted 1529
11 SASI_Hs01_00153187 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081022 predicted 730
2 SASI_Rn01_00081023 predicted 900
3 SASI_Rn01_00081024 predicted 1016
4 SASI_Rn02_00200342 predicted 1064
5 SASI_Rn01_00081025 predicted 1703
6 SASI_Rn01_00081027 predicted 1125
7 SASI_Rn01_00081028 predicted 1337
8 SASI_Rn01_00081029 predicted 832
9 SASI_Rn01_00081030 predicted 1386
10 SASI_Rn01_00081031 predicted 1065
11 SASI_Rn01_00081026 predicted 2097
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160649 predicted 730
2 SASI_Rn01_00160650 predicted 897
3 SASI_Rn01_00160651 predicted 1015
4 SASI_Rn01_00160652 predicted 1072
5 SASI_Rn01_00160653 predicted 1036
6 SASI_Rn01_00160654 predicted 2156
7 SASI_Rn01_00160655 predicted 1130
8 SASI_Rn01_00160656 predicted 1334
9 SASI_Rn01_00160657 predicted 838
10 SASI_Rn01_00160658 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172252 predicted 806
2 SASI_Mm01_00172254 predicted 664
3 SASI_Mm01_00172256 predicted 1226
4 SASI_Mm01_00172257 predicted 821
5 SASI_Mm02_00334386 predicted 1020
6 SASI_Mm01_00172258 predicted 1622
7 SASI_Mm01_00172259 predicted 1283
8 SASI_Mm01_00172260 predicted 1202
9 SASI_Mm01_00172261 predicted 602
10 SASI_Mm02_00334387 predicted 903
11 SASI_Mm01_00172253 predicted 467
12 SASI_Mm01_00172255 predicted 1415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028780
VALIDATED
TM9SF1 MISSION shRNA Bacterial Glycerol Stock
transmembrane 9 superfamily member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-2273s1c1
Sequence:CCGGGCCACAGAACTCTGGCTCTTTCTCGAGAAAGAGCCAGAGTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-1881s1c1
Sequence:CCGGCGTGGAGCTGTACTACATCTTCTCGAGAAGATGTAGTACAGCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-606s1c1
Sequence:CCGGCCCTCAGGAAACTTACCACTACTCGAGTAGTGGTAAGTTTCCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-1025s1c1
Sequence:CCGGCTGATGAATTGCTGGGCCTTACTCGAGTAAGGCCCAGCAATTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028780.2-1146s1c1
Sequence:CCGGCCATTGGTTGTCCATCATCAACTCGAGTTGATGATGGACAACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028780
VALIDATED
TM9SF1 MISSION shRNA shRNA Plasmid DNA
transmembrane 9 superfamily member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-2273s1c1
Sequence:CCGGGCCACAGAACTCTGGCTCTTTCTCGAGAAAGAGCCAGAGTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-1881s1c1
Sequence:CCGGCGTGGAGCTGTACTACATCTTCTCGAGAAGATGTAGTACAGCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-606s1c1
Sequence:CCGGCCCTCAGGAAACTTACCACTACTCGAGTAGTGGTAAGTTTCCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-1025s1c1
Sequence:CCGGCTGATGAATTGCTGGGCCTTACTCGAGTAAGGCCCAGCAATTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028780.2-1146s1c1
Sequence:CCGGCCATTGGTTGTCCATCATCAACTCGAGTTGATGATGGACAACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028780
VALIDATED
TM9SF1 MISSION shRNA Lentiviral Transduction Particles
transmembrane 9 superfamily member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-2273s1c1
Sequence:CCGGGCCACAGAACTCTGGCTCTTTCTCGAGAAAGAGCCAGAGTTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-1881s1c1
Sequence:CCGGCGTGGAGCTGTACTACATCTTCTCGAGAAGATGTAGTACAGCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-606s1c1
Sequence:CCGGCCCTCAGGAAACTTACCACTACTCGAGTAGTGGTAAGTTTCCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028780.2-1025s1c1
Sequence:CCGGCTGATGAATTGCTGGGCCTTACTCGAGTAAGGCCCAGCAATTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028780.2-1146s1c1
Sequence:CCGGCCATTGGTTGTCCATCATCAACTCGAGTTGATGATGGACAACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006405
VALIDATED
TM9SF1 MISSION shRNA Bacterial Glycerol Stock
transmembrane 9 superfamily member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006405.3-169s1c1
Sequence:CCGGCCTACCATAACCCTCAGGAAACTCGAGTTTCCTGAGGGTTATGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006405.3-1802s1c1
Sequence:CCGGCATCCGGTATATCTATGTTAACTCGAGTTAACATAGATATACCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006405.3-222s1c1
Sequence:CCGGCCTGAGAAGATACGTCACAAACTCGAGTTTGTGACGTATCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006405.3-1496s1c1
Sequence:CCGGGCAGTACACTTTGTACGGCATCTCGAGATGCCGTACAAAGTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006405.3-702s1c1
Sequence:CCGGCCTCGAACACTGGAAATCCATCTCGAGATGGATTTCCAGTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006405.5-553s21c1
Sequence:CCGGCCTGAGAAGATACGTCACAAACTCGAGTTTGTGACGTATCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006405.5-1033s21c1
Sequence:CCGGCCTCGAACACTGGAAATCCATCTCGAGATGGATTTCCAGTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006405.5-2133s21c1
Sequence:CCGGCATCCGGTATATCTATGTTAACTCGAGTTAACATAGATATACCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006405.5-1827s21c1
Sequence:CCGGGCAGTACACTTTGTACGGCATCTCGAGATGCCGTACAAAGTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006405
VALIDATED
TM9SF1 MISSION shRNA shRNA Plasmid DNA
transmembrane 9 superfamily member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006405.3-169s1c1
Sequence:CCGGCCTACCATAACCCTCAGGAAACTCGAGTTTCCTGAGGGTTATGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006405.3-1802s1c1
Sequence:CCGGCATCCGGTATATCTATGTTAACTCGAGTTAACATAGATATACCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006405.3-222s1c1
Sequence:CCGGCCTGAGAAGATACGTCACAAACTCGAGTTTGTGACGTATCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006405.3-1496s1c1
Sequence:CCGGGCAGTACACTTTGTACGGCATCTCGAGATGCCGTACAAAGTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006405.3-702s1c1
Sequence:CCGGCCTCGAACACTGGAAATCCATCTCGAGATGGATTTCCAGTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006405.5-553s21c1
Sequence:CCGGCCTGAGAAGATACGTCACAAACTCGAGTTTGTGACGTATCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006405.5-1033s21c1
Sequence:CCGGCCTCGAACACTGGAAATCCATCTCGAGATGGATTTCCAGTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006405.5-2133s21c1
Sequence:CCGGCATCCGGTATATCTATGTTAACTCGAGTTAACATAGATATACCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006405.5-1827s21c1
Sequence:CCGGGCAGTACACTTTGTACGGCATCTCGAGATGCCGTACAAAGTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006405
VALIDATED
TM9SF1 MISSION shRNA Lentiviral Transduction Particles
transmembrane 9 superfamily member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006405.3-169s1c1
Sequence:CCGGCCTACCATAACCCTCAGGAAACTCGAGTTTCCTGAGGGTTATGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006405.3-1802s1c1
Sequence:CCGGCATCCGGTATATCTATGTTAACTCGAGTTAACATAGATATACCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006405.3-222s1c1
Sequence:CCGGCCTGAGAAGATACGTCACAAACTCGAGTTTGTGACGTATCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006405.3-1496s1c1
Sequence:CCGGGCAGTACACTTTGTACGGCATCTCGAGATGCCGTACAAAGTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006405.3-702s1c1
Sequence:CCGGCCTCGAACACTGGAAATCCATCTCGAGATGGATTTCCAGTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006405.5-553s21c1
Sequence:CCGGCCTGAGAAGATACGTCACAAACTCGAGTTTGTGACGTATCTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006405.5-1033s21c1
Sequence:CCGGCCTCGAACACTGGAAATCCATCTCGAGATGGATTTCCAGTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006405.5-2133s21c1
Sequence:CCGGCATCCGGTATATCTATGTTAACTCGAGTTAACATAGATATACCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006405.5-1827s21c1
Sequence:CCGGGCAGTACACTTTGTACGGCATCTCGAGATGCCGTACAAAGTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks