EMAIL THIS PAGE TO A FRIEND

TM9SF2

transmembrane 9 superfamily member 2

Synonyms: P76
UniProtKB ID: Q99805, A8K399, Q2TAY5
Gene ID:
Human(9375) Summary: This gene encodes a member of the transmembrane 9 superfamily. The encoded 76 kDa protein localizes to early endosomes in human cells. The encoded protein possesses a conserved and highly hydrophobic C-terminal domain which contains nine transmembrane domains. The protein may play a role in small molecule transport or act as an ion channel. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Oct 2012]
Mouse(68059) transmembrane 9 superfamily member 2
Rat(306197) transmembrane 9 superfamily member 2
cow(514455) transmembrane 9 superfamily member 2
sheep(101111977) transmembrane 9 superfamily member 2
domestic guinea pig(100724136) transmembrane 9 superfamily member 2
naked mole-rat(101714789) transmembrane 9 superfamily member 2
Domestic Rabbit(100353059) transmembrane 9 superfamily member 2
Zebrafish(334370) transmembrane 9 superfamily member 2
chicken(418777) transmembrane 9 superfamily member 2
dog(476972) transmembrane 9 superfamily member 2
Horse(100061300) transmembrane 9 superfamily member 2
domestic cat(101101536) transmembrane 9 superfamily member 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004800 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004800 Rosetta Predictions human pricing
NM_001005554 Rosetta Predictions rat pricing
NM_080556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011448 predicted 1843
2 SASI_Hs01_00011451 predicted 1169
3 SASI_Hs02_00338334 predicted 1861
4 SASI_Hs01_00011452 predicted 1546
5 SASI_Hs01_00011453 predicted 2007
6 SASI_Hs01_00011454 predicted 1375
7 SASI_Hs02_00338335 predicted 358
8 SASI_Hs01_00011455 predicted 1641
9 SASI_Hs01_00011456 predicted 1261
10 SASI_Hs01_00011457 predicted 1039
11 SASI_Hs01_00011449 predicted 493
12 SASI_Hs01_00011450 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067204 predicted 965
2 SASI_Rn01_00067205 predicted 1873
3 SASI_Rn01_00067207 predicted 1403
4 SASI_Rn01_00067208 predicted 2017
5 SASI_Rn01_00067209 predicted 485
6 SASI_Rn01_00067210 predicted 1672
7 SASI_Rn01_00067211 predicted 336
8 SASI_Rn01_00067212 predicted 724
9 SASI_Rn01_00067213 predicted 1131
10 SASI_Rn02_00198416 predicted 610
11 SASI_Rn01_00067206 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140758 predicted 975
2 SASI_Mm01_00140760 predicted 1893
3 SASI_Mm02_00338154 predicted 625
4 SASI_Mm02_00338155 predicted 951
5 SASI_Mm01_00140761 predicted 742
6 SASI_Mm01_00140762 predicted 2044
7 SASI_Mm01_00140764 predicted 728
8 SASI_Mm01_00140765 predicted 817
9 SASI_Mm01_00140767 predicted 540
10 SASI_Mm02_00338156 predicted 2259
11 SASI_Mm01_00140759 predicted 2054
12 SASI_Mm01_00140763 predicted 854
13 SASI_Mm01_00140766 predicted 1641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080556
VALIDATED
TM9SF2 MISSION shRNA Bacterial Glycerol Stock
transmembrane 9 superfamily member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080556.3-1827s21c1
Sequence:CCGGCCACCAGATGTATTACATGTTCTCGAGAACATGTAATACATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080556.3-1033s21c1
Sequence:CCGGGCGTCTAGGTGGGACTATATTCTCGAGAATATAGTCCCACCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080556.3-2540s21c1
Sequence:CCGGCGGTAGGTGGAAAGAATTATTCTCGAGAATAATTCTTTCCACCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080556.3-508s21c1
Sequence:CCGGCCGTATAAGTTTACGTTTAATCTCGAGATTAAACGTAAACTTATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080556.2-504s1c1
Sequence:CCGGCTCACCGTATAAGTTTACGTTCTCGAGAACGTAAACTTATACGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080556.2-2541s1c1
Sequence:CCGGCGGTAGGTGGAAAGAATTATTCTCGAGAATAATTCTTTCCACCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080556.2-406s1c1
Sequence:CCGGCCTTATGAATATACAGCGTTTCTCGAGAAACGCTGTATATTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080556.2-1827s1c1
Sequence:CCGGCCACCAGATGTATTACATGTTCTCGAGAACATGTAATACATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080556
VALIDATED
TM9SF2 MISSION shRNA shRNA Plasmid DNA
transmembrane 9 superfamily member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080556.3-1827s21c1
Sequence:CCGGCCACCAGATGTATTACATGTTCTCGAGAACATGTAATACATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080556.3-1033s21c1
Sequence:CCGGGCGTCTAGGTGGGACTATATTCTCGAGAATATAGTCCCACCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080556.3-2540s21c1
Sequence:CCGGCGGTAGGTGGAAAGAATTATTCTCGAGAATAATTCTTTCCACCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080556.3-508s21c1
Sequence:CCGGCCGTATAAGTTTACGTTTAATCTCGAGATTAAACGTAAACTTATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080556.2-504s1c1
Sequence:CCGGCTCACCGTATAAGTTTACGTTCTCGAGAACGTAAACTTATACGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080556.2-2541s1c1
Sequence:CCGGCGGTAGGTGGAAAGAATTATTCTCGAGAATAATTCTTTCCACCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080556.2-406s1c1
Sequence:CCGGCCTTATGAATATACAGCGTTTCTCGAGAAACGCTGTATATTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080556.2-1827s1c1
Sequence:CCGGCCACCAGATGTATTACATGTTCTCGAGAACATGTAATACATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080556
VALIDATED
TM9SF2 MISSION shRNA Lentiviral Transduction Particles
transmembrane 9 superfamily member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080556.3-1827s21c1
Sequence:CCGGCCACCAGATGTATTACATGTTCTCGAGAACATGTAATACATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080556.3-1033s21c1
Sequence:CCGGGCGTCTAGGTGGGACTATATTCTCGAGAATATAGTCCCACCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080556.3-2540s21c1
Sequence:CCGGCGGTAGGTGGAAAGAATTATTCTCGAGAATAATTCTTTCCACCTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080556.3-508s21c1
Sequence:CCGGCCGTATAAGTTTACGTTTAATCTCGAGATTAAACGTAAACTTATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080556.2-504s1c1
Sequence:CCGGCTCACCGTATAAGTTTACGTTCTCGAGAACGTAAACTTATACGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080556.2-2541s1c1
Sequence:CCGGCGGTAGGTGGAAAGAATTATTCTCGAGAATAATTCTTTCCACCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080556.2-406s1c1
Sequence:CCGGCCTTATGAATATACAGCGTTTCTCGAGAAACGCTGTATATTCATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080556.2-1827s1c1
Sequence:CCGGCCACCAGATGTATTACATGTTCTCGAGAACATGTAATACATCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004800
VALIDATED
TM9SF2 MISSION shRNA Bacterial Glycerol Stock
transmembrane 9 superfamily member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004800.1-2212s21c1
Sequence:CCGGCAGAATTATTGGCCTAGTAATCTCGAGATTACTAGGCCAATAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-300s21c1
Sequence:CCGGGCAAGGCCGAAATAGAACTATCTCGAGATAGTTCTATTTCGGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-1388s21c1
Sequence:CCGGGCCAGATTCTATAAGTCCTTTCTCGAGAAAGGACTTATAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-983s21c1
Sequence:CCGGGCGTCTAGATGGGACTATATTCTCGAGAATATAGTCCCATCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-1180s21c1
Sequence:CCGGACTTGTTCATGGTGATATATTCTCGAGAATATATCACCATGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-711s1c1
Sequence:CCGGCCTGTGTTATTAGTTCAGATTCTCGAGAATCTGAACTAATAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-1880s1c1
Sequence:CCGGGCAGAGGATTATCATTGGCAACTCGAGTTGCCAATGATAATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-300s1c1
Sequence:CCGGGCAAGGCCGAAATAGAACTATCTCGAGATAGTTCTATTTCGGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-827s1c1
Sequence:CCGGGCTGCTAAACTTGAACCGAAACTCGAGTTTCGGTTCAAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-1388s1c1
Sequence:CCGGGCCAGATTCTATAAGTCCTTTCTCGAGAAAGGACTTATAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004800
VALIDATED
TM9SF2 MISSION shRNA shRNA Plasmid DNA
transmembrane 9 superfamily member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004800.1-2212s21c1
Sequence:CCGGCAGAATTATTGGCCTAGTAATCTCGAGATTACTAGGCCAATAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-300s21c1
Sequence:CCGGGCAAGGCCGAAATAGAACTATCTCGAGATAGTTCTATTTCGGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-1388s21c1
Sequence:CCGGGCCAGATTCTATAAGTCCTTTCTCGAGAAAGGACTTATAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-983s21c1
Sequence:CCGGGCGTCTAGATGGGACTATATTCTCGAGAATATAGTCCCATCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-1180s21c1
Sequence:CCGGACTTGTTCATGGTGATATATTCTCGAGAATATATCACCATGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-711s1c1
Sequence:CCGGCCTGTGTTATTAGTTCAGATTCTCGAGAATCTGAACTAATAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-1880s1c1
Sequence:CCGGGCAGAGGATTATCATTGGCAACTCGAGTTGCCAATGATAATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-300s1c1
Sequence:CCGGGCAAGGCCGAAATAGAACTATCTCGAGATAGTTCTATTTCGGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-827s1c1
Sequence:CCGGGCTGCTAAACTTGAACCGAAACTCGAGTTTCGGTTCAAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-1388s1c1
Sequence:CCGGGCCAGATTCTATAAGTCCTTTCTCGAGAAAGGACTTATAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004800
VALIDATED
TM9SF2 MISSION shRNA Lentiviral Transduction Particles
transmembrane 9 superfamily member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004800.1-2212s21c1
Sequence:CCGGCAGAATTATTGGCCTAGTAATCTCGAGATTACTAGGCCAATAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-300s21c1
Sequence:CCGGGCAAGGCCGAAATAGAACTATCTCGAGATAGTTCTATTTCGGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-1388s21c1
Sequence:CCGGGCCAGATTCTATAAGTCCTTTCTCGAGAAAGGACTTATAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-983s21c1
Sequence:CCGGGCGTCTAGATGGGACTATATTCTCGAGAATATAGTCCCATCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004800.1-1180s21c1
Sequence:CCGGACTTGTTCATGGTGATATATTCTCGAGAATATATCACCATGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-711s1c1
Sequence:CCGGCCTGTGTTATTAGTTCAGATTCTCGAGAATCTGAACTAATAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-1880s1c1
Sequence:CCGGGCAGAGGATTATCATTGGCAACTCGAGTTGCCAATGATAATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-300s1c1
Sequence:CCGGGCAAGGCCGAAATAGAACTATCTCGAGATAGTTCTATTTCGGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-827s1c1
Sequence:CCGGGCTGCTAAACTTGAACCGAAACTCGAGTTTCGGTTCAAGTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004800.1-1388s1c1
Sequence:CCGGGCCAGATTCTATAAGTCCTTTCTCGAGAAAGGACTTATAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks