EMAIL THIS PAGE TO A FRIEND

TM9SF3

transmembrane 9 superfamily member 3

Synonyms: EP70-P-iso SMBP
UniProtKB ID: Q9HD45, Q5TB57, Q6UWE7, Q9NWL8, Q9P0G9, Q9UHW8
Gene ID:
Mouse(107358) transmembrane 9 superfamily member 3
Rat(309475) transmembrane 9 superfamily member 3
Zebrafish(406698) transmembrane 9 superfamily member 3
chicken(395460) transmembrane 9 superfamily member 3
Horse(100070803) transmembrane 9 superfamily member 3
domestic cat(101097763) transmembrane 9 superfamily member 3
dog(612786) transmembrane 9 superfamily member 3
naked mole-rat(101720356) transmembrane 9 superfamily member 3
domestic guinea pig(100714083) transmembrane 9 superfamily member 3
domestic guinea pig(100379268) transmembrane 9 superfamily member 3
cow(614147) transmembrane 9 superfamily member 3
sheep(101112014) transmembrane 9 superfamily member 3
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020123 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020123 Rosetta Predictions human pricing
XM_220013 Rosetta Predictions rat pricing
NM_133352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047500 predicted 1446
2 SASI_Hs01_00047501 predicted 1681
3 SASI_Hs01_00047502 predicted 1899
4 SASI_Hs01_00047503 predicted 2064
5 SASI_Hs01_00047504 predicted 1542
6 SASI_Hs02_00352985 predicted 756
7 SASI_Hs01_00047506 predicted 1481
8 SASI_Hs01_00047507 predicted 2000
9 SASI_Hs01_00047508 predicted 966
10 SASI_Hs01_00047509 predicted 1066
11 SASI_Hs01_00047505 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378925 predicted 887
2 SASI_Rn02_00378926 predicted 962
3 SASI_Rn02_00378927 predicted 929
4 SASI_Rn02_00378928 predicted 1815
5 SASI_Rn02_00378929 predicted 1528
6 SASI_Rn02_00378930 predicted 1816
7 SASI_Rn02_00378931 predicted 1323
8 SASI_Rn02_00378932 predicted 1663
9 SASI_Rn02_00378933 predicted 1197
10 SASI_Rn02_00378934 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086645 predicted 1727
2 SASI_Mm01_00086647 predicted 1904
3 SASI_Mm01_00086648 predicted 625
4 SASI_Mm01_00086649 predicted 1072
5 SASI_Mm01_00086650 predicted 702
6 SASI_Mm01_00086651 predicted 642
7 SASI_Mm01_00086652 predicted 1377
8 SASI_Mm02_00338532 predicted 1765
9 SASI_Mm01_00086653 predicted 1557
10 SASI_Mm02_00338533 predicted 1161
11 SASI_Mm01_00086646 predicted 1771
12 SASI_Mm01_00086654 predicted 1779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020123
VALIDATED
TM9SF3 MISSION shRNA Bacterial Glycerol Stock
transmembrane 9 superfamily member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020123.2-527s1c1
Sequence:CCGGCCAGCCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020123.2-977s1c1
Sequence:CCGGCGGTACAGTAAAGAGGAAGAACTCGAGTTCTTCCTCTTTACTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020123.2-1624s1c1
Sequence:CCGGCACGTCTTTCTGGGCATATAACTCGAGTTATATGCCCAGAAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020123.2-1923s1c1
Sequence:CCGGCGATTGGTTACATGGGAACAACTCGAGTTGTTCCCATGTAACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-527s21c1
Sequence:CCGGCCAGCCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-1624s21c1
Sequence:CCGGCACGTCTTTCTGGGCATATAACTCGAGTTATATGCCCAGAAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-977s21c1
Sequence:CCGGCGGTACAGTAAAGAGGAAGAACTCGAGTTCTTCCTCTTTACTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-1923s21c1
Sequence:CCGGCGATTGGTTACATGGGAACAACTCGAGTTGTTCCCATGTAACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020123
VALIDATED
TM9SF3 MISSION shRNA shRNA Plasmid DNA
transmembrane 9 superfamily member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020123.2-527s1c1
Sequence:CCGGCCAGCCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020123.2-977s1c1
Sequence:CCGGCGGTACAGTAAAGAGGAAGAACTCGAGTTCTTCCTCTTTACTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020123.2-1624s1c1
Sequence:CCGGCACGTCTTTCTGGGCATATAACTCGAGTTATATGCCCAGAAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020123.2-1923s1c1
Sequence:CCGGCGATTGGTTACATGGGAACAACTCGAGTTGTTCCCATGTAACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-527s21c1
Sequence:CCGGCCAGCCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-1624s21c1
Sequence:CCGGCACGTCTTTCTGGGCATATAACTCGAGTTATATGCCCAGAAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-977s21c1
Sequence:CCGGCGGTACAGTAAAGAGGAAGAACTCGAGTTCTTCCTCTTTACTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-1923s21c1
Sequence:CCGGCGATTGGTTACATGGGAACAACTCGAGTTGTTCCCATGTAACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020123
VALIDATED
TM9SF3 MISSION shRNA Lentiviral Transduction Particles
transmembrane 9 superfamily member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020123.2-527s1c1
Sequence:CCGGCCAGCCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020123.2-977s1c1
Sequence:CCGGCGGTACAGTAAAGAGGAAGAACTCGAGTTCTTCCTCTTTACTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020123.2-1624s1c1
Sequence:CCGGCACGTCTTTCTGGGCATATAACTCGAGTTATATGCCCAGAAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020123.2-1923s1c1
Sequence:CCGGCGATTGGTTACATGGGAACAACTCGAGTTGTTCCCATGTAACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-527s21c1
Sequence:CCGGCCAGCCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-1624s21c1
Sequence:CCGGCACGTCTTTCTGGGCATATAACTCGAGTTATATGCCCAGAAAGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-977s21c1
Sequence:CCGGCGGTACAGTAAAGAGGAAGAACTCGAGTTCTTCCTCTTTACTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020123.3-1923s21c1
Sequence:CCGGCGATTGGTTACATGGGAACAACTCGAGTTGTTCCCATGTAACCAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178146
VALIDATED
TM9SF3 MISSION shRNA Bacterial Glycerol Stock
transmembrane 9 superfamily member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-1958s1c1
Sequence:CCGGGCAAGAAGAGATTTGGGCTTACTCGAGTAAGCCCAAATCTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-422s1c1
Sequence:CCGGCCAGGCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-821s1c1
Sequence:CCGGGTGGGATTAGTTTCAATGATTCTCGAGAATCATTGAAACTAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-330s1c1
Sequence:CCGGTCAGTCATTACCATGAAACTTCTCGAGAAGTTTCATGGTAATGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178146.2-261s1c1
Sequence:CCGGCCTACCACAATCGCCAAGAAACTCGAGTTTCTTGGCGATTGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178146
VALIDATED
TM9SF3 MISSION shRNA shRNA Plasmid DNA
transmembrane 9 superfamily member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-1958s1c1
Sequence:CCGGGCAAGAAGAGATTTGGGCTTACTCGAGTAAGCCCAAATCTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-422s1c1
Sequence:CCGGCCAGGCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-821s1c1
Sequence:CCGGGTGGGATTAGTTTCAATGATTCTCGAGAATCATTGAAACTAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-330s1c1
Sequence:CCGGTCAGTCATTACCATGAAACTTCTCGAGAAGTTTCATGGTAATGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178146.2-261s1c1
Sequence:CCGGCCTACCACAATCGCCAAGAAACTCGAGTTTCTTGGCGATTGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178146
VALIDATED
TM9SF3 MISSION shRNA Lentiviral Transduction Particles
transmembrane 9 superfamily member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-1958s1c1
Sequence:CCGGGCAAGAAGAGATTTGGGCTTACTCGAGTAAGCCCAAATCTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-422s1c1
Sequence:CCGGCCAGGCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-821s1c1
Sequence:CCGGGTGGGATTAGTTTCAATGATTCTCGAGAATCATTGAAACTAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178146.2-330s1c1
Sequence:CCGGTCAGTCATTACCATGAAACTTCTCGAGAAGTTTCATGGTAATGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178146.2-261s1c1
Sequence:CCGGCCTACCACAATCGCCAAGAAACTCGAGTTTCTTGGCGATTGTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133352
VALIDATED
TM9SF3 MISSION shRNA Bacterial Glycerol Stock
transmembrane 9 superfamily member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-1551s21c1
Sequence:CCGGCACGTCCTTCTGGGCATATAACTCGAGTTATATGCCCAGAAGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-362s21c1
Sequence:CCGGTCAGTCATTACCATGAAACTTCTCGAGAAGTTTCATGGTAATGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-1992s21c1
Sequence:CCGGGCAAGAAGAGATTTGGGCTTACTCGAGTAAGCCCAAATCTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-454s21c1
Sequence:CCGGCCAGGCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-853s21c1
Sequence:CCGGGTGGGATTAGTTTCAATGATTCTCGAGAATCATTGAAACTAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133352
VALIDATED
TM9SF3 MISSION shRNA shRNA Plasmid DNA
transmembrane 9 superfamily member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-1551s21c1
Sequence:CCGGCACGTCCTTCTGGGCATATAACTCGAGTTATATGCCCAGAAGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-362s21c1
Sequence:CCGGTCAGTCATTACCATGAAACTTCTCGAGAAGTTTCATGGTAATGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-1992s21c1
Sequence:CCGGGCAAGAAGAGATTTGGGCTTACTCGAGTAAGCCCAAATCTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-454s21c1
Sequence:CCGGCCAGGCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-853s21c1
Sequence:CCGGGTGGGATTAGTTTCAATGATTCTCGAGAATCATTGAAACTAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133352
VALIDATED
TM9SF3 MISSION shRNA Lentiviral Transduction Particles
transmembrane 9 superfamily member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-1551s21c1
Sequence:CCGGCACGTCCTTCTGGGCATATAACTCGAGTTATATGCCCAGAAGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-362s21c1
Sequence:CCGGTCAGTCATTACCATGAAACTTCTCGAGAAGTTTCATGGTAATGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-1992s21c1
Sequence:CCGGGCAAGAAGAGATTTGGGCTTACTCGAGTAAGCCCAAATCTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-454s21c1
Sequence:CCGGCCAGGCACTTACTGTGAAATTCTCGAGAATTTCACAGTAAGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133352.2-853s21c1
Sequence:CCGGGTGGGATTAGTTTCAATGATTCTCGAGAATCATTGAAACTAATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks