EMAIL THIS PAGE TO A FRIEND

TM9SF4

transmembrane 9 superfamily protein member 4

Synonyms: dJ836N17.2
UniProtKB ID: Q92544, B0QYT7, Q9NUA3
Gene ID:
Mouse(99237) transmembrane 9 superfamily protein member 4
Rat(296279) transmembrane 9 superfamily protein member 4
cow(533562) transmembrane 9 superfamily protein member 4
sheep(101113428) transmembrane 9 superfamily protein member 4
domestic guinea pig(100733724) transmembrane 9 superfamily protein member 4
naked mole-rat(101708606) transmembrane 9 superfamily protein member 4
fruit fly(34778) CG7364 gene product from transcript CG7364-RA
domestic cat(101094838) transmembrane 9 superfamily protein member 4
dog(477191) transmembrane 9 superfamily protein member 4
chicken(419281) transmembrane 9 superfamily protein member 4
Zebrafish(393482) transmembrane 9 superfamily protein member 4
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014742 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014742 Rosetta Predictions human pricing
NM_001025649 Rosetta Predictions rat pricing
NM_133847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126714 predicted 1118
2 SASI_Hs01_00126715 predicted 1114
3 SASI_Hs02_00346204 predicted 323
4 SASI_Hs01_00126717 predicted 529
5 SASI_Hs01_00126718 predicted 451
6 SASI_Hs01_00126719 predicted 617
7 SASI_Hs01_00126720 predicted 505
8 SASI_Hs01_00126721 predicted 1794
9 SASI_Hs02_00346205 predicted 387
10 SASI_Hs01_00126722 predicted 2107
11 SASI_Hs01_00126716 predicted 537
12 SASI_Hs01_00126723 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057948 predicted 239
2 SASI_Rn01_00057949 predicted 580
3 SASI_Rn01_00057950 predicted 1407
4 SASI_Rn01_00057951 predicted 511
5 SASI_Rn01_00057952 predicted 1591
6 SASI_Rn01_00057953 predicted 254
7 SASI_Rn01_00057954 predicted 253
8 SASI_Rn01_00057955 predicted 365
9 SASI_Rn01_00057956 predicted 413
10 SASI_Rn01_00057957 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028254 predicted 1989
2 SASI_Mm01_00028255 predicted 797
3 SASI_Mm01_00028256 predicted 1726
4 SASI_Mm02_00338884 predicted 2140
5 SASI_Mm01_00028257 predicted 1912
6 SASI_Mm01_00028258 predicted 1532
7 SASI_Mm01_00028259 predicted 985
8 SASI_Mm01_00028261 predicted 1642
9 SASI_Mm01_00028262 predicted 1058
10 SASI_Mm01_00028263 predicted 305
11 SASI_Mm01_00028260 predicted 1516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133847
VALIDATED
TM9SF4 MISSION shRNA Bacterial Glycerol Stock
transmembrane 9 superfamily protein member 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-1739s21c1
Sequence:CCGGCGGTGGTACATGAACCGATTTCTCGAGAAATCGGTTCATGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-1648s21c1
Sequence:CCGGTGTCTACTTGGGCTACTATTTCTCGAGAAATAGTAGCCCAAGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-419s21c1
Sequence:CCGGCCTTACGAGTACTACTCATTGCTCGAGCAATGAGTAGTACTCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133847.3-2378s21c1
Sequence:CCGGCCAGTCTGTAGGGATACATTTCTCGAGAAATGTATCCCTACAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-622s21c1
Sequence:CCGGCGAGCGAATCACAGAAGAATACTCGAGTATTCTTCTGTGATTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133847.2-3048s1c1
Sequence:CCGGCCGCACTTTGTAAAGGGTGATCTCGAGATCACCCTTTACAAAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133847.2-345s1c1
Sequence:CCGGCGCCAATCAATTTCCACCAAACTCGAGTTTGGTGGAAATTGATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133847.2-1187s1c1
Sequence:CCGGGCCAACTACAACAAGGAGGATCTCGAGATCCTCCTTGTTGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133847.2-622s1c1
Sequence:CCGGCGAGCGAATCACAGAAGAATACTCGAGTATTCTTCTGTGATTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133847
VALIDATED
TM9SF4 MISSION shRNA shRNA Plasmid DNA
transmembrane 9 superfamily protein member 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-1739s21c1
Sequence:CCGGCGGTGGTACATGAACCGATTTCTCGAGAAATCGGTTCATGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-1648s21c1
Sequence:CCGGTGTCTACTTGGGCTACTATTTCTCGAGAAATAGTAGCCCAAGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-419s21c1
Sequence:CCGGCCTTACGAGTACTACTCATTGCTCGAGCAATGAGTAGTACTCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133847.3-2378s21c1
Sequence:CCGGCCAGTCTGTAGGGATACATTTCTCGAGAAATGTATCCCTACAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-622s21c1
Sequence:CCGGCGAGCGAATCACAGAAGAATACTCGAGTATTCTTCTGTGATTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133847.2-3048s1c1
Sequence:CCGGCCGCACTTTGTAAAGGGTGATCTCGAGATCACCCTTTACAAAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133847.2-345s1c1
Sequence:CCGGCGCCAATCAATTTCCACCAAACTCGAGTTTGGTGGAAATTGATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133847.2-1187s1c1
Sequence:CCGGGCCAACTACAACAAGGAGGATCTCGAGATCCTCCTTGTTGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133847.2-622s1c1
Sequence:CCGGCGAGCGAATCACAGAAGAATACTCGAGTATTCTTCTGTGATTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133847
VALIDATED
TM9SF4 MISSION shRNA Lentiviral Transduction Particles
transmembrane 9 superfamily protein member 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-1739s21c1
Sequence:CCGGCGGTGGTACATGAACCGATTTCTCGAGAAATCGGTTCATGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-1648s21c1
Sequence:CCGGTGTCTACTTGGGCTACTATTTCTCGAGAAATAGTAGCCCAAGTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-419s21c1
Sequence:CCGGCCTTACGAGTACTACTCATTGCTCGAGCAATGAGTAGTACTCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133847.3-2378s21c1
Sequence:CCGGCCAGTCTGTAGGGATACATTTCTCGAGAAATGTATCCCTACAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133847.3-622s21c1
Sequence:CCGGCGAGCGAATCACAGAAGAATACTCGAGTATTCTTCTGTGATTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133847.2-3048s1c1
Sequence:CCGGCCGCACTTTGTAAAGGGTGATCTCGAGATCACCCTTTACAAAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133847.2-345s1c1
Sequence:CCGGCGCCAATCAATTTCCACCAAACTCGAGTTTGGTGGAAATTGATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133847.2-1187s1c1
Sequence:CCGGGCCAACTACAACAAGGAGGATCTCGAGATCCTCCTTGTTGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133847.2-622s1c1
Sequence:CCGGCGAGCGAATCACAGAAGAATACTCGAGTATTCTTCTGTGATTCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014742
VALIDATED
TM9SF4 MISSION shRNA Bacterial Glycerol Stock
transmembrane 9 superfamily protein member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-384s21c1
Sequence:CCGGCTCGAACCCAGCTACCTTATGCTCGAGCATAAGGTAGCTGGGTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-781s21c1
Sequence:CCGGCCTCTCATTCATCCTTTACTACTCGAGTAGTAAAGGATGAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-604s21c1
Sequence:CCGGGCGGATCACAGAAGACTACTACTCGAGTAGTAGTCTTCTGTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-2498s21c1
Sequence:CCGGATGGATCCAGGATGGATAAATCTCGAGATTTATCCATCCTGGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-1508s21c1
Sequence:CCGGTTTGGCATCTGCTTCGTATTGCTCGAGCAATACGAAGCAGATGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-1473s1c1
Sequence:CCGGCGGTGGTACATGAACCGATTTCTCGAGAAATCGGTTCATGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-362s1c1
Sequence:CCGGGCGGATCACAGAAGACTACTACTCGAGTAGTAGTCTTCTGTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014742.2-1728s1c1
Sequence:CCGGGCATTCTACGTCCTGGTTTATCTCGAGATAAACCAGGACGTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-539s1c1
Sequence:CCGGCCTCTCATTCATCCTTTACTACTCGAGTAGTAAAGGATGAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-83s1c1
Sequence:CCGGGCCTATCAACTTCCACCAGAACTCGAGTTCTGGTGGAAGTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014742
VALIDATED
TM9SF4 MISSION shRNA shRNA Plasmid DNA
transmembrane 9 superfamily protein member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-384s21c1
Sequence:CCGGCTCGAACCCAGCTACCTTATGCTCGAGCATAAGGTAGCTGGGTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-781s21c1
Sequence:CCGGCCTCTCATTCATCCTTTACTACTCGAGTAGTAAAGGATGAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-604s21c1
Sequence:CCGGGCGGATCACAGAAGACTACTACTCGAGTAGTAGTCTTCTGTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-2498s21c1
Sequence:CCGGATGGATCCAGGATGGATAAATCTCGAGATTTATCCATCCTGGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-1508s21c1
Sequence:CCGGTTTGGCATCTGCTTCGTATTGCTCGAGCAATACGAAGCAGATGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-1473s1c1
Sequence:CCGGCGGTGGTACATGAACCGATTTCTCGAGAAATCGGTTCATGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-362s1c1
Sequence:CCGGGCGGATCACAGAAGACTACTACTCGAGTAGTAGTCTTCTGTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014742.2-1728s1c1
Sequence:CCGGGCATTCTACGTCCTGGTTTATCTCGAGATAAACCAGGACGTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-539s1c1
Sequence:CCGGCCTCTCATTCATCCTTTACTACTCGAGTAGTAAAGGATGAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-83s1c1
Sequence:CCGGGCCTATCAACTTCCACCAGAACTCGAGTTCTGGTGGAAGTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014742
VALIDATED
TM9SF4 MISSION shRNA Lentiviral Transduction Particles
transmembrane 9 superfamily protein member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-384s21c1
Sequence:CCGGCTCGAACCCAGCTACCTTATGCTCGAGCATAAGGTAGCTGGGTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-781s21c1
Sequence:CCGGCCTCTCATTCATCCTTTACTACTCGAGTAGTAAAGGATGAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-604s21c1
Sequence:CCGGGCGGATCACAGAAGACTACTACTCGAGTAGTAGTCTTCTGTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-2498s21c1
Sequence:CCGGATGGATCCAGGATGGATAAATCTCGAGATTTATCCATCCTGGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014742.3-1508s21c1
Sequence:CCGGTTTGGCATCTGCTTCGTATTGCTCGAGCAATACGAAGCAGATGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-1473s1c1
Sequence:CCGGCGGTGGTACATGAACCGATTTCTCGAGAAATCGGTTCATGTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-362s1c1
Sequence:CCGGGCGGATCACAGAAGACTACTACTCGAGTAGTAGTCTTCTGTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014742.2-1728s1c1
Sequence:CCGGGCATTCTACGTCCTGGTTTATCTCGAGATAAACCAGGACGTAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-539s1c1
Sequence:CCGGCCTCTCATTCATCCTTTACTACTCGAGTAGTAAAGGATGAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014742.2-83s1c1
Sequence:CCGGGCCTATCAACTTCCACCAGAACTCGAGTTCTGGTGGAAGTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks