EMAIL THIS PAGE TO A FRIEND

TMA16

translation machinery associated 16 homolog (S. cerevisiae)

Synonyms: C4orf43
UniProtKB ID: Q96EY4, Q0P6E4, Q0P6J1, Q9NUR7
Gene ID:
Mouse(66282) translation machinery associated 16 homolog (S. cerevisiae)
Rat(290686) translation machinery associated 16 homolog (S. cerevisiae)
cow(506277) translation machinery associated 16 homolog (S. cerevisiae)
sheep(101106328) translation machinery associated 16 homolog (S. cerevisiae)
naked mole-rat(101726017) translation machinery associated 16 homolog (S. cerevisiae)
domestic guinea pig(100724161) translation machinery associated 16 homolog (S. cerevisiae)
Zebrafish(553647) translation machinery associated 16 homolog (S. cerevisiae)
domestic cat(101099118) translation machinery associated 16 homolog (S. cerevisiae)
dog(475487) translation machinery associated 16 homolog (S. cerevisiae)
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0066 AQUA Peptide LNLVGE[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018352 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107731 MISSION® esiRNA esiRNA human C4orf43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018352 Rosetta Predictions human pricing
XM_001073162 Rosetta Predictions rat pricing
XM_214332 Rosetta Predictions rat pricing
NM_025465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168950 predicted 930
2 SASI_Hs01_00168952 predicted 1025
3 SASI_Hs02_00351807 predicted 1152
4 SASI_Hs02_00351808 predicted 950
5 SASI_Hs01_00168953 predicted 884
6 SASI_Hs02_00351809 predicted 1100
7 SASI_Hs01_00168955 predicted 982
8 SASI_Hs01_00168956 predicted 1184
9 SASI_Hs01_00168957 predicted 671
10 SASI_Hs02_00351810 predicted 802
11 SASI_Hs01_00168951 predicted 791
12 SASI_Hs01_00168954 predicted 605
13 SASI_Hs01_00168958 predicted 671
14 SASI_Hs01_00168959 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341730 predicted 862
2 SASI_Rn02_00341731 predicted 873
3 SASI_Rn02_00341732 predicted 937
4 SASI_Rn02_00341733 predicted 1102
5 SASI_Rn02_00341734 predicted 1093
6 SASI_Rn02_00341735 predicted 983
7 SASI_Rn02_00341736 predicted 866
8 SASI_Rn02_00341737 predicted 985
9 SASI_Rn02_00341738 predicted 1141
10 SASI_Rn02_00341739 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195779 predicted 342
2 SASI_Rn01_00195780 predicted 346
3 SASI_Rn01_00195781 predicted 349
4 SASI_Rn01_00195782 predicted 449
5 SASI_Rn01_00195783 predicted 341
6 SASI_Rn01_00195785 predicted 438
7 SASI_Rn01_00195786 predicted 398
8 SASI_Rn01_00195787 predicted 404
9 SASI_Rn01_00195788 predicted 439
10 SASI_Rn02_00375239 predicted 398
11 SASI_Rn01_00195784 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134190 predicted 782
2 SASI_Mm01_00134191 predicted 851
3 SASI_Mm01_00134192 predicted 656
4 SASI_Mm01_00134193 predicted 686
5 SASI_Mm01_00134194 predicted 745
6 SASI_Mm01_00134195 predicted 544
7 SASI_Mm01_00134196 predicted 494
8 SASI_Mm01_00134198 predicted 737
9 SASI_Mm01_00134199 predicted 581
10 SASI_Mm02_00328320 predicted 590
11 SASI_Mm01_00134197 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018352
TMA16 MISSION shRNA Bacterial Glycerol Stock
translation machinery associated 16 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-598s1c1
Sequence:CCGGCGCTAATGATGCAATTCCCAACTCGAGTTGGGAATTGCATCATTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-473s1c1
Sequence:CCGGCGACAGCAGTTTGAGGGATATCTCGAGATATCCCTCAAACTGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018352.1-1590s1c1
Sequence:CCGGGAGCACAATGTAGGTGTATTTCTCGAGAAATACACCTACATTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018352.1-496s1c1
Sequence:CCGGCCTTGAGATTCCAGACATTCTCTCGAGAGAATGTCTGGAATCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018352.1-377s1c1
Sequence:CCGGCTGGAGCAGATTGAGTTACATCTCGAGATGTAACTCAATCTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-679s1c1
Sequence:CCGGCGATGAATCAAGTGATTCAGACTCGAGTCTGAATCACTTGATTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-391s1c1
Sequence:CCGGGTTACATAACAGTATCAGGGACTCGAGTCCCTGATACTGTTATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018352.1-1066s1c1
Sequence:CCGGGTAACCTGTTTCCTGAAAGATCTCGAGATCTTTCAGGAAACAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018352.2-1103s21c1
Sequence:CCGGGTGATCTGCAGAAGTTGTTTACTCGAGTAAACAACTTCTGCAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018352.2-668s21c1
Sequence:CCGGTGAGATTCCAGACATTCTAAACTCGAGTTTAGAATGTCTGGAATCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018352.2-1192s21c1
Sequence:CCGGGTGTATTTATGATCACCTAATCTCGAGATTAGGTGATCATAAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018352.2-876s21c1
Sequence:CCGGATGACTGCAGTGGCCTAATTGCTCGAGCAATTAGGCCACTGCAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018352
TMA16 MISSION shRNA shRNA Plasmid DNA
translation machinery associated 16 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-598s1c1
Sequence:CCGGCGCTAATGATGCAATTCCCAACTCGAGTTGGGAATTGCATCATTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-473s1c1
Sequence:CCGGCGACAGCAGTTTGAGGGATATCTCGAGATATCCCTCAAACTGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018352.1-1590s1c1
Sequence:CCGGGAGCACAATGTAGGTGTATTTCTCGAGAAATACACCTACATTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018352.1-496s1c1
Sequence:CCGGCCTTGAGATTCCAGACATTCTCTCGAGAGAATGTCTGGAATCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018352.1-377s1c1
Sequence:CCGGCTGGAGCAGATTGAGTTACATCTCGAGATGTAACTCAATCTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-679s1c1
Sequence:CCGGCGATGAATCAAGTGATTCAGACTCGAGTCTGAATCACTTGATTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-391s1c1
Sequence:CCGGGTTACATAACAGTATCAGGGACTCGAGTCCCTGATACTGTTATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018352.1-1066s1c1
Sequence:CCGGGTAACCTGTTTCCTGAAAGATCTCGAGATCTTTCAGGAAACAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018352.2-1103s21c1
Sequence:CCGGGTGATCTGCAGAAGTTGTTTACTCGAGTAAACAACTTCTGCAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018352.2-668s21c1
Sequence:CCGGTGAGATTCCAGACATTCTAAACTCGAGTTTAGAATGTCTGGAATCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018352.2-1192s21c1
Sequence:CCGGGTGTATTTATGATCACCTAATCTCGAGATTAGGTGATCATAAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018352.2-876s21c1
Sequence:CCGGATGACTGCAGTGGCCTAATTGCTCGAGCAATTAGGCCACTGCAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018352
TMA16 MISSION shRNA Lentiviral Transduction Particles
translation machinery associated 16 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-598s1c1
Sequence:CCGGCGCTAATGATGCAATTCCCAACTCGAGTTGGGAATTGCATCATTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-473s1c1
Sequence:CCGGCGACAGCAGTTTGAGGGATATCTCGAGATATCCCTCAAACTGCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018352.1-1590s1c1
Sequence:CCGGGAGCACAATGTAGGTGTATTTCTCGAGAAATACACCTACATTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018352.1-496s1c1
Sequence:CCGGCCTTGAGATTCCAGACATTCTCTCGAGAGAATGTCTGGAATCTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018352.1-377s1c1
Sequence:CCGGCTGGAGCAGATTGAGTTACATCTCGAGATGTAACTCAATCTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-679s1c1
Sequence:CCGGCGATGAATCAAGTGATTCAGACTCGAGTCTGAATCACTTGATTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018352.1-391s1c1
Sequence:CCGGGTTACATAACAGTATCAGGGACTCGAGTCCCTGATACTGTTATGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018352.1-1066s1c1
Sequence:CCGGGTAACCTGTTTCCTGAAAGATCTCGAGATCTTTCAGGAAACAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018352.2-1103s21c1
Sequence:CCGGGTGATCTGCAGAAGTTGTTTACTCGAGTAAACAACTTCTGCAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018352.2-668s21c1
Sequence:CCGGTGAGATTCCAGACATTCTAAACTCGAGTTTAGAATGTCTGGAATCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018352.2-1192s21c1
Sequence:CCGGGTGTATTTATGATCACCTAATCTCGAGATTAGGTGATCATAAATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018352.2-876s21c1
Sequence:CCGGATGACTGCAGTGGCCTAATTGCTCGAGCAATTAGGCCACTGCAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025465
VALIDATED
TMA16 MISSION shRNA Bacterial Glycerol Stock
translation machinery associated 16 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-465s1c1
Sequence:CCGGCGAAGGCTATGGCTTTGAGATCTCGAGATCTCAAAGCCATAGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-256s1c1
Sequence:CCGGCTTCAATGGTTTCACAGTCATCTCGAGATGACTGTGAAACCATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-589s1c1
Sequence:CCGGGCAGTTCCTAAGAAGCGCAAACTCGAGTTTGCGCTTCTTAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-792s1c1
Sequence:CCGGCCATGGCACATAGTCATTTATCTCGAGATAAATGACTATGTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025465.2-465s21c1
Sequence:CCGGCGAAGGCTATGGCTTTGAGATCTCGAGATCTCAAAGCCATAGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025465.2-227s21c1
Sequence:CCGGCCTTGCGTCTCAACCTTATTGCTCGAGCAATAAGGTTGAGACGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025465.2-256s21c1
Sequence:CCGGCTTCAATGGTTTCACAGTCATCTCGAGATGACTGTGAAACCATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025465.2-371s21c1
Sequence:CCGGAGTTACAGAACAGCATCAAAGCTCGAGCTTTGATGCTGTTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025465.2-792s21c1
Sequence:CCGGCCATGGCACATAGTCATTTATCTCGAGATAAATGACTATGTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025465
VALIDATED
TMA16 MISSION shRNA shRNA Plasmid DNA
translation machinery associated 16 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-465s1c1
Sequence:CCGGCGAAGGCTATGGCTTTGAGATCTCGAGATCTCAAAGCCATAGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-256s1c1
Sequence:CCGGCTTCAATGGTTTCACAGTCATCTCGAGATGACTGTGAAACCATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-589s1c1
Sequence:CCGGGCAGTTCCTAAGAAGCGCAAACTCGAGTTTGCGCTTCTTAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-792s1c1
Sequence:CCGGCCATGGCACATAGTCATTTATCTCGAGATAAATGACTATGTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025465.2-465s21c1
Sequence:CCGGCGAAGGCTATGGCTTTGAGATCTCGAGATCTCAAAGCCATAGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025465.2-227s21c1
Sequence:CCGGCCTTGCGTCTCAACCTTATTGCTCGAGCAATAAGGTTGAGACGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025465.2-256s21c1
Sequence:CCGGCTTCAATGGTTTCACAGTCATCTCGAGATGACTGTGAAACCATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025465.2-371s21c1
Sequence:CCGGAGTTACAGAACAGCATCAAAGCTCGAGCTTTGATGCTGTTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025465.2-792s21c1
Sequence:CCGGCCATGGCACATAGTCATTTATCTCGAGATAAATGACTATGTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025465
VALIDATED
TMA16 MISSION shRNA Lentiviral Transduction Particles
translation machinery associated 16 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-465s1c1
Sequence:CCGGCGAAGGCTATGGCTTTGAGATCTCGAGATCTCAAAGCCATAGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-256s1c1
Sequence:CCGGCTTCAATGGTTTCACAGTCATCTCGAGATGACTGTGAAACCATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-589s1c1
Sequence:CCGGGCAGTTCCTAAGAAGCGCAAACTCGAGTTTGCGCTTCTTAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025465.1-792s1c1
Sequence:CCGGCCATGGCACATAGTCATTTATCTCGAGATAAATGACTATGTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025465.2-465s21c1
Sequence:CCGGCGAAGGCTATGGCTTTGAGATCTCGAGATCTCAAAGCCATAGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025465.2-227s21c1
Sequence:CCGGCCTTGCGTCTCAACCTTATTGCTCGAGCAATAAGGTTGAGACGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025465.2-256s21c1
Sequence:CCGGCTTCAATGGTTTCACAGTCATCTCGAGATGACTGTGAAACCATTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025465.2-371s21c1
Sequence:CCGGAGTTACAGAACAGCATCAAAGCTCGAGCTTTGATGCTGTTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025465.2-792s21c1
Sequence:CCGGCCATGGCACATAGTCATTTATCTCGAGATAAATGACTATGTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks