EMAIL THIS PAGE TO A FRIEND

TMA7

translation machinery associated 7 homolog (S. cerevisiae)

Synonyms: CCDC72
UniProtKB ID: Q9Y2S6, Q9P052
Gene ID:
Mouse(66167) translational machinery associated 7 homolog (S. cerevisiae)
Rat(679747) translational machinery associated 7 homolog
Zebrafish(768290) translational machinery associated 7 homolog (S. cerevisiae)
chicken(770887) translational machinery associated 7 homolog (S. cerevisiae)
domestic cat(101087907) translational machinery associated 7 homolog (S. cerevisiae)
dog(609068) translational machinery associated 7 homolog (S. cerevisiae)
naked mole-rat(101713360) translation machinery associated 7 homolog (S. cerevisiae)
cow(615251) coiled-coil domain containing 72
sheep(101111494) translational machinery associated 7 homolog (S. cerevisiae)
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047397 Anti-TMA7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015933 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015933 Rosetta Predictions human pricing
NM_001126048 Rosetta Predictions rat pricing
NM_183250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348558 predicted 331
2 SASI_Hs02_00348559 predicted 386
3 SASI_Hs02_00348560 predicted 87
4 SASI_Hs02_00348561 predicted 189
5 SASI_Hs02_00348562 predicted 419
6 SASI_Hs02_00348563 predicted 186
7 SASI_Hs02_00348564 predicted 231
8 SASI_Hs02_00348565 predicted 267
9 SASI_Hs02_00348566 predicted 301
10 SASI_Hs02_00348567 predicted 36
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252793 predicted 237
2 SASI_Rn02_00252794 predicted 589
3 SASI_Rn02_00252795 predicted 543
4 SASI_Rn02_00252796 predicted 577
5 SASI_Rn02_00252797 predicted 295
6 SASI_Rn02_00252798 predicted 391
7 SASI_Rn02_00252799 predicted 591
8 SASI_Rn02_00252800 predicted 373
9 SASI_Rn02_00252801 predicted 580
10 SASI_Rn02_00252802 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350330 predicted 335
2 SASI_Mm02_00350331 predicted 140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183250
VALIDATED
TMA7 MISSION shRNA Bacterial Glycerol Stock
translation machinery associated 7 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-96s21c1
Sequence:CCGGCAAGGAGATGGACGAGGAAGACTCGAGTCTTCCTCGTCCATCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-150s21c1
Sequence:CCGGGAAGAAACTCGAAGAGCTAAACTCGAGTTTAGCTCTTCGAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-195s21c1
Sequence:CCGGCCTGGCCACAGGTGGAATTAACTCGAGTTAATTCCACCTGTGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-230s21c1
Sequence:CCGGAGTAAGCTGTTCCTCACATCTCTCGAGAGATGTGAGGAACAGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-266s21c1
Sequence:CCGGCTCCTCTTCCATTCCTATTTACTCGAGTAAATAGGAATGGAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183250.1-265s1c1
Sequence:CCGGCCCTCCTCTTCCATTCCTATTCTCGAGAATAGGAATGGAAGAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183250.1-378s1c1
Sequence:CCGGCATAACATCTTTGCCATGTAACTCGAGTTACATGGCAAAGATGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183250.1-143s1c1
Sequence:CCGGGAGGAACAGAAGAAACTCGAACTCGAGTTCGAGTTTCTTCTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183250
VALIDATED
TMA7 MISSION shRNA shRNA Plasmid DNA
translation machinery associated 7 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-96s21c1
Sequence:CCGGCAAGGAGATGGACGAGGAAGACTCGAGTCTTCCTCGTCCATCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-150s21c1
Sequence:CCGGGAAGAAACTCGAAGAGCTAAACTCGAGTTTAGCTCTTCGAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-195s21c1
Sequence:CCGGCCTGGCCACAGGTGGAATTAACTCGAGTTAATTCCACCTGTGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-230s21c1
Sequence:CCGGAGTAAGCTGTTCCTCACATCTCTCGAGAGATGTGAGGAACAGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-266s21c1
Sequence:CCGGCTCCTCTTCCATTCCTATTTACTCGAGTAAATAGGAATGGAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183250.1-265s1c1
Sequence:CCGGCCCTCCTCTTCCATTCCTATTCTCGAGAATAGGAATGGAAGAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183250.1-378s1c1
Sequence:CCGGCATAACATCTTTGCCATGTAACTCGAGTTACATGGCAAAGATGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183250.1-143s1c1
Sequence:CCGGGAGGAACAGAAGAAACTCGAACTCGAGTTCGAGTTTCTTCTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183250
VALIDATED
TMA7 MISSION shRNA Lentiviral Transduction Particles
translation machinery associated 7 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-96s21c1
Sequence:CCGGCAAGGAGATGGACGAGGAAGACTCGAGTCTTCCTCGTCCATCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-150s21c1
Sequence:CCGGGAAGAAACTCGAAGAGCTAAACTCGAGTTTAGCTCTTCGAGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-195s21c1
Sequence:CCGGCCTGGCCACAGGTGGAATTAACTCGAGTTAATTCCACCTGTGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-230s21c1
Sequence:CCGGAGTAAGCTGTTCCTCACATCTCTCGAGAGATGTGAGGAACAGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183250.2-266s21c1
Sequence:CCGGCTCCTCTTCCATTCCTATTTACTCGAGTAAATAGGAATGGAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183250.1-265s1c1
Sequence:CCGGCCCTCCTCTTCCATTCCTATTCTCGAGAATAGGAATGGAAGAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183250.1-378s1c1
Sequence:CCGGCATAACATCTTTGCCATGTAACTCGAGTTACATGGCAAAGATGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183250.1-143s1c1
Sequence:CCGGGAGGAACAGAAGAAACTCGAACTCGAGTTCGAGTTTCTTCTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015933
TMA7 MISSION shRNA Bacterial Glycerol Stock
translation machinery associated 7 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-105s1c1
Sequence:CCGGGACGAGGAAGATAAGGCTTTCCTCGAGGAAAGCCTTATCTTCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-99s1c1
Sequence:CCGGGAGATGGACGAGGAAGATAAGCTCGAGCTTATCTTCCTCGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-114s1c1
Sequence:CCGGGATAAGGCTTTCAAGCAGAAACTCGAGTTTCTGCTTGAAAGCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-205s1c1
Sequence:CCGGGTGGAATTAAGAAATCTGGCACTCGAGTGCCAGATTTCTTAATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-202s1c1
Sequence:CCGGCAGGTGGAATTAAGAAATCTGCTCGAGCAGATTTCTTAATTCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-108s1c1
Sequence:CCGGGAGGAAGATAAGGCTTTCAAGCTCGAGCTTGAAAGCCTTATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-198s1c1
Sequence:CCGGGCCACAGGTGGAATTAAGAAACTCGAGTTTCTTAATTCCACCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015933.2-300s1c1
Sequence:CCGGGCCACGTATAGCTGGAATTAACTCGAGTTAATTCCAGCTATACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-107s1c1
Sequence:CCGGCGAGGAAGATAAGGCTTTCAACTCGAGTTGAAAGCCTTATCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015933
TMA7 MISSION shRNA shRNA Plasmid DNA
translation machinery associated 7 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-105s1c1
Sequence:CCGGGACGAGGAAGATAAGGCTTTCCTCGAGGAAAGCCTTATCTTCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-99s1c1
Sequence:CCGGGAGATGGACGAGGAAGATAAGCTCGAGCTTATCTTCCTCGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-114s1c1
Sequence:CCGGGATAAGGCTTTCAAGCAGAAACTCGAGTTTCTGCTTGAAAGCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-205s1c1
Sequence:CCGGGTGGAATTAAGAAATCTGGCACTCGAGTGCCAGATTTCTTAATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-202s1c1
Sequence:CCGGCAGGTGGAATTAAGAAATCTGCTCGAGCAGATTTCTTAATTCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-108s1c1
Sequence:CCGGGAGGAAGATAAGGCTTTCAAGCTCGAGCTTGAAAGCCTTATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-198s1c1
Sequence:CCGGGCCACAGGTGGAATTAAGAAACTCGAGTTTCTTAATTCCACCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015933.2-300s1c1
Sequence:CCGGGCCACGTATAGCTGGAATTAACTCGAGTTAATTCCAGCTATACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-107s1c1
Sequence:CCGGCGAGGAAGATAAGGCTTTCAACTCGAGTTGAAAGCCTTATCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015933
TMA7 MISSION shRNA Lentiviral Transduction Particles
translation machinery associated 7 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-105s1c1
Sequence:CCGGGACGAGGAAGATAAGGCTTTCCTCGAGGAAAGCCTTATCTTCCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-99s1c1
Sequence:CCGGGAGATGGACGAGGAAGATAAGCTCGAGCTTATCTTCCTCGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-114s1c1
Sequence:CCGGGATAAGGCTTTCAAGCAGAAACTCGAGTTTCTGCTTGAAAGCCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-205s1c1
Sequence:CCGGGTGGAATTAAGAAATCTGGCACTCGAGTGCCAGATTTCTTAATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-202s1c1
Sequence:CCGGCAGGTGGAATTAAGAAATCTGCTCGAGCAGATTTCTTAATTCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-108s1c1
Sequence:CCGGGAGGAAGATAAGGCTTTCAAGCTCGAGCTTGAAAGCCTTATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-198s1c1
Sequence:CCGGGCCACAGGTGGAATTAAGAAACTCGAGTTTCTTAATTCCACCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015933.2-300s1c1
Sequence:CCGGGCCACGTATAGCTGGAATTAACTCGAGTTAATTCCAGCTATACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015933.1-107s1c1
Sequence:CCGGCGAGGAAGATAAGGCTTTCAACTCGAGTTGAAAGCCTTATCTTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks