EMAIL THIS PAGE TO A FRIEND

TMBIM1

transmembrane BAX inhibitor motif containing 1

Synonyms: LFG3 MST100 MSTP100 RECS1
UniProtKB ID: Q969X1, B3KQY6, Q8N1R3, Q8TAM3, Q96K13
Gene ID:
Mouse(69660) transmembrane BAX inhibitor motif containing 1
Rat(316516) transmembrane BAX inhibitor motif containing 1
Zebrafish(449819) transmembrane BAX inhibitor motif containing 1
dog(610419) transmembrane BAX inhibitor motif containing 1
chicken(424218) transmembrane BAX inhibitor motif containing 1
domestic cat(101086997) transmembrane BAX inhibitor motif containing 1
cow(404134) transmembrane BAX inhibitor motif containing 1
sheep(101109777) transmembrane BAX inhibitor motif containing 1
naked mole-rat(101709939) transmembrane BAX inhibitor motif containing 1
domestic guinea pig(100723041) transmembrane BAX inhibitor motif containing 1
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022152 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022152 Rosetta Predictions human pricing
NM_001007713 Rosetta Predictions rat pricing
NM_027154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210927 predicted 678
2 SASI_Hs02_00355567 predicted 841
3 SASI_Hs01_00210930 predicted 835
4 SASI_Hs01_00210932 predicted 610
5 SASI_Hs01_00210934 predicted 842
6 SASI_Hs01_00210935 predicted 657
7 SASI_Hs02_00355568 predicted 725
8 SASI_Hs02_00355569 predicted 404
9 SASI_Hs02_00355570 predicted 788
10 SASI_Hs02_00355571 predicted 681
11 SASI_Hs01_00210926 predicted 739
12 SASI_Hs01_00210928 predicted 706
13 SASI_Hs01_00210929 predicted 532
14 SASI_Hs01_00210931 predicted 554
15 SASI_Hs01_00210933 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098578 predicted 539
2 SASI_Rn01_00098579 predicted 247
3 SASI_Rn01_00098580 predicted 591
4 SASI_Rn01_00098581 predicted 612
5 SASI_Rn02_00198897 predicted 929
6 SASI_Rn01_00098583 predicted 722
7 SASI_Rn01_00098584 predicted 572
8 SASI_Rn02_00198898 predicted 428
9 SASI_Rn01_00098586 predicted 534
10 SASI_Rn01_00098587 predicted 583
11 SASI_Rn01_00098582 predicted 464
12 SASI_Rn01_00098585 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020037 predicted 785
2 SASI_Mm01_00020038 predicted 934
3 SASI_Mm01_00020039 predicted 953
4 SASI_Mm01_00020040 predicted 766
5 SASI_Mm01_00020041 predicted 480
6 SASI_Mm01_00020042 predicted 596
7 SASI_Mm01_00020043 predicted 270
8 SASI_Mm01_00020044 predicted 605
9 SASI_Mm01_00020046 predicted 470
10 SASI_Mm02_00331670 predicted 370
11 SASI_Mm01_00020045 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022152
VALIDATED
TMBIM1 MISSION shRNA Bacterial Glycerol Stock
transmembrane BAX inhibitor motif containing 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-543s1c1
Sequence:CCGGCCGTTTCCCATGGAACATCATCTCGAGATGATGTTCCATGGGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-469s1c1
Sequence:CCGGGCTGTCTACTACGTGTCCTATCTCGAGATAGGACACGTAGTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-624s1c1
Sequence:CCGGCCAAACCAAAGCCGTCATCATCTCGAGATGATGACGGCTTTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-762s1c1
Sequence:CCGGGACTGGGATTGTCACTAGCATCTCGAGATGCTAGTGACAATCCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022152.3-939s1c1
Sequence:CCGGGATTTACACAGACATCATCTACTCGAGTAGATGATGTCTGTGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-411s1c1
Sequence:CCGGCATCATTGCTATCTTCACCTTCTCGAGAAGGTGAAGATAGCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-363s1c1
Sequence:CCGGCCGAAAGGTTTACTCCATCATCTCGAGATGATGGAGTAAACCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-784s1c1
Sequence:CCGGGTGCTCTACTTCCAATACGTTCTCGAGAACGTATTGGAAGTAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-840s1c1
Sequence:CCGGCATTTGTTTCACCCTGTTCCTCTCGAGAGGAACAGGGTGAAACAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-429s21c1
Sequence:CCGGCCGAAAGGTTTACTCCATCATCTCGAGATGATGGAGTAAACCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-477s21c1
Sequence:CCGGCATCATTGCTATCTTCACCTTCTCGAGAAGGTGAAGATAGCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-850s21c1
Sequence:CCGGGTGCTCTACTTCCAATACGTTCTCGAGAACGTATTGGAAGTAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-535s21c1
Sequence:CCGGGCTGTCTACTACGTGTCCTATCTCGAGATAGGACACGTAGTAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-609s21c1
Sequence:CCGGCCGTTTCCCATGGAACATCATCTCGAGATGATGTTCCATGGGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022152
VALIDATED
TMBIM1 MISSION shRNA shRNA Plasmid DNA
transmembrane BAX inhibitor motif containing 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-543s1c1
Sequence:CCGGCCGTTTCCCATGGAACATCATCTCGAGATGATGTTCCATGGGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-469s1c1
Sequence:CCGGGCTGTCTACTACGTGTCCTATCTCGAGATAGGACACGTAGTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-624s1c1
Sequence:CCGGCCAAACCAAAGCCGTCATCATCTCGAGATGATGACGGCTTTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-762s1c1
Sequence:CCGGGACTGGGATTGTCACTAGCATCTCGAGATGCTAGTGACAATCCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022152.3-939s1c1
Sequence:CCGGGATTTACACAGACATCATCTACTCGAGTAGATGATGTCTGTGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-411s1c1
Sequence:CCGGCATCATTGCTATCTTCACCTTCTCGAGAAGGTGAAGATAGCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-363s1c1
Sequence:CCGGCCGAAAGGTTTACTCCATCATCTCGAGATGATGGAGTAAACCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-784s1c1
Sequence:CCGGGTGCTCTACTTCCAATACGTTCTCGAGAACGTATTGGAAGTAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-840s1c1
Sequence:CCGGCATTTGTTTCACCCTGTTCCTCTCGAGAGGAACAGGGTGAAACAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-429s21c1
Sequence:CCGGCCGAAAGGTTTACTCCATCATCTCGAGATGATGGAGTAAACCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-477s21c1
Sequence:CCGGCATCATTGCTATCTTCACCTTCTCGAGAAGGTGAAGATAGCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-850s21c1
Sequence:CCGGGTGCTCTACTTCCAATACGTTCTCGAGAACGTATTGGAAGTAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-535s21c1
Sequence:CCGGGCTGTCTACTACGTGTCCTATCTCGAGATAGGACACGTAGTAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-609s21c1
Sequence:CCGGCCGTTTCCCATGGAACATCATCTCGAGATGATGTTCCATGGGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022152
VALIDATED
TMBIM1 MISSION shRNA Lentiviral Transduction Particles
transmembrane BAX inhibitor motif containing 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-543s1c1
Sequence:CCGGCCGTTTCCCATGGAACATCATCTCGAGATGATGTTCCATGGGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-469s1c1
Sequence:CCGGGCTGTCTACTACGTGTCCTATCTCGAGATAGGACACGTAGTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-624s1c1
Sequence:CCGGCCAAACCAAAGCCGTCATCATCTCGAGATGATGACGGCTTTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-762s1c1
Sequence:CCGGGACTGGGATTGTCACTAGCATCTCGAGATGCTAGTGACAATCCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022152.3-939s1c1
Sequence:CCGGGATTTACACAGACATCATCTACTCGAGTAGATGATGTCTGTGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-411s1c1
Sequence:CCGGCATCATTGCTATCTTCACCTTCTCGAGAAGGTGAAGATAGCAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-363s1c1
Sequence:CCGGCCGAAAGGTTTACTCCATCATCTCGAGATGATGGAGTAAACCTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-784s1c1
Sequence:CCGGGTGCTCTACTTCCAATACGTTCTCGAGAACGTATTGGAAGTAGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_022152.3-840s1c1
Sequence:CCGGCATTTGTTTCACCCTGTTCCTCTCGAGAGGAACAGGGTGAAACAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-429s21c1
Sequence:CCGGCCGAAAGGTTTACTCCATCATCTCGAGATGATGGAGTAAACCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-477s21c1
Sequence:CCGGCATCATTGCTATCTTCACCTTCTCGAGAAGGTGAAGATAGCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-850s21c1
Sequence:CCGGGTGCTCTACTTCCAATACGTTCTCGAGAACGTATTGGAAGTAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-535s21c1
Sequence:CCGGGCTGTCTACTACGTGTCCTATCTCGAGATAGGACACGTAGTAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_022152.4-609s21c1
Sequence:CCGGCCGTTTCCCATGGAACATCATCTCGAGATGATGTTCCATGGGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027154
VALIDATED
TMBIM1 MISSION shRNA Bacterial Glycerol Stock
transmembrane BAX inhibitor motif containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027154.3-1941s1c1
Sequence:CCGGGCTGCTTTCTATGTAATCCAACTCGAGTTGGATTACATAGAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-342s21c1
Sequence:CCGGTGACCGGAAAGTTCGACATTCCTCGAGGAATGTCGAACTTTCCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-599s21c1
Sequence:CCGGGCTTTGTGACAGGCACTATTTCTCGAGAAATAGTGCCTGTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-1231s21c1
Sequence:CCGGCCTTTACCCATGACGAGTATGCTCGAGCATACTCGTCATGGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027154.4-275s21c1
Sequence:CCGGACTACGGCCATGACTATAATGCTCGAGCATTATAGTCATGGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-438s21c1
Sequence:CCGGTGTGGAACCAGTCGGCAAATACTCGAGTATTTGCCGACTGGTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027154
VALIDATED
TMBIM1 MISSION shRNA shRNA Plasmid DNA
transmembrane BAX inhibitor motif containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027154.3-1941s1c1
Sequence:CCGGGCTGCTTTCTATGTAATCCAACTCGAGTTGGATTACATAGAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-342s21c1
Sequence:CCGGTGACCGGAAAGTTCGACATTCCTCGAGGAATGTCGAACTTTCCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-599s21c1
Sequence:CCGGGCTTTGTGACAGGCACTATTTCTCGAGAAATAGTGCCTGTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-1231s21c1
Sequence:CCGGCCTTTACCCATGACGAGTATGCTCGAGCATACTCGTCATGGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027154.4-275s21c1
Sequence:CCGGACTACGGCCATGACTATAATGCTCGAGCATTATAGTCATGGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-438s21c1
Sequence:CCGGTGTGGAACCAGTCGGCAAATACTCGAGTATTTGCCGACTGGTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027154
VALIDATED
TMBIM1 MISSION shRNA Lentiviral Transduction Particles
transmembrane BAX inhibitor motif containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027154.3-1941s1c1
Sequence:CCGGGCTGCTTTCTATGTAATCCAACTCGAGTTGGATTACATAGAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-342s21c1
Sequence:CCGGTGACCGGAAAGTTCGACATTCCTCGAGGAATGTCGAACTTTCCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-599s21c1
Sequence:CCGGGCTTTGTGACAGGCACTATTTCTCGAGAAATAGTGCCTGTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-1231s21c1
Sequence:CCGGCCTTTACCCATGACGAGTATGCTCGAGCATACTCGTCATGGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027154.4-275s21c1
Sequence:CCGGACTACGGCCATGACTATAATGCTCGAGCATTATAGTCATGGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027154.4-438s21c1
Sequence:CCGGTGTGGAACCAGTCGGCAAATACTCGAGTATTTGCCGACTGGTTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks