EMAIL THIS PAGE TO A FRIEND

TMBIM4

transmembrane BAX inhibitor motif containing 4

Synonyms: GAAP LFG4 S1R ZPRO
UniProtKB ID: Q9HC24, Q542Z6, Q9UHY5, Q9Y3C2
Gene ID:
Mouse(68212) transmembrane BAX inhibitor motif containing 4
Rat(362884) transmembrane BAX inhibitor motif containing 4
cow(513242) transmembrane BAX inhibitor motif containing 4
sheep(101115532) transmembrane BAX inhibitor motif containing 4
domestic guinea pig(100735215) transmembrane BAX inhibitor motif containing 4
naked mole-rat(101705235) transmembrane BAX inhibitor motif containing 4
Zebrafish(406412) transmembrane BAX inhibitor motif containing 4
domestic cat(101090118) transmembrane BAX inhibitor motif containing 4
dog(474432) transmembrane BAX inhibitor motif containing 4
chicken(771874) transmembrane BAX inhibitor motif containing 4
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016056 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016056 Rosetta Predictions human pricing
NM_199116 Rosetta Predictions rat pricing
NM_026617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228074 predicted 256
2 SASI_Hs01_00228075 predicted 245
3 SASI_Hs01_00228076 predicted 299
4 SASI_Hs01_00228079 predicted 304
5 SASI_Hs01_00228077 predicted 302
6 SASI_Hs01_00228080 predicted 303
7 SASI_Hs01_00228082 predicted 268
8 SASI_Hs02_00348786 predicted 246
9 SASI_Hs02_00348787 predicted 353
10 SASI_Hs02_00348788 predicted 505
11 SASI_Hs01_00228078 predicted 318
12 SASI_Hs01_00228081 predicted 261
13 SASI_Hs01_00228083 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117827 predicted 431
2 SASI_Rn01_00117828 predicted 400
3 SASI_Rn01_00117829 predicted 219
4 SASI_Rn01_00117830 predicted 295
5 SASI_Rn01_00117831 predicted 433
6 SASI_Rn01_00117832 predicted 479
7 SASI_Rn01_00117833 predicted 584
8 SASI_Rn01_00117834 predicted 479
9 SASI_Rn01_00117835 predicted 498
10 SASI_Rn01_00117836 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185076 predicted 204
2 SASI_Mm01_00185077 predicted 377
3 SASI_Mm01_00185078 predicted 307
4 SASI_Mm01_00185079 predicted 429
5 SASI_Mm01_00185080 predicted 251
6 SASI_Mm01_00185081 predicted 436
7 SASI_Mm01_00185083 predicted 427
8 SASI_Mm01_00185084 predicted 307
9 SASI_Mm01_00185085 predicted 363
10 SASI_Mm02_00330580 predicted 441
11 SASI_Mm01_00185082 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016056
VALIDATED
TMBIM4 MISSION shRNA Bacterial Glycerol Stock
transmembrane BAX inhibitor motif containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016056.2-867s21c1
Sequence:CCGGGCAGTATATAGAAACTGTTTCCTCGAGGAAACAGTTTCTATATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016056.2-668s21c1
Sequence:CCGGACACACTCACTGATGCATAAACTCGAGTTTATGCATCAGTGAGTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016056.2-603s21c1
Sequence:CCGGAGATAATGGAGTTGGTCTTAGCTCGAGCTAAGACCAACTCCATTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016056.1-256s1c1
Sequence:CCGGGTACATGAGAGTCCTGCCTTACTCGAGTAAGGCAGGACTCTCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016056.1-316s1c1
Sequence:CCGGGCGTTGACTTTAAACAGACATCTCGAGATGTCTGTTTAAAGTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016056.1-439s1c1
Sequence:CCGGGCTTTCATACTGACTACTACACTCGAGTGTAGTAGTCAGTATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016056.1-989s1c1
Sequence:CCGGCTTGATTTAGGATCTCAGTTACTCGAGTAACTGAGATCCTAAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016056.1-397s1c1
Sequence:CCGGGCAGTTGTTGTTACTTTCTATCTCGAGATAGAAAGTAACAACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016056
VALIDATED
TMBIM4 MISSION shRNA shRNA Plasmid DNA
transmembrane BAX inhibitor motif containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016056.2-867s21c1
Sequence:CCGGGCAGTATATAGAAACTGTTTCCTCGAGGAAACAGTTTCTATATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016056.2-668s21c1
Sequence:CCGGACACACTCACTGATGCATAAACTCGAGTTTATGCATCAGTGAGTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016056.2-603s21c1
Sequence:CCGGAGATAATGGAGTTGGTCTTAGCTCGAGCTAAGACCAACTCCATTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016056.1-256s1c1
Sequence:CCGGGTACATGAGAGTCCTGCCTTACTCGAGTAAGGCAGGACTCTCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016056.1-316s1c1
Sequence:CCGGGCGTTGACTTTAAACAGACATCTCGAGATGTCTGTTTAAAGTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016056.1-439s1c1
Sequence:CCGGGCTTTCATACTGACTACTACACTCGAGTGTAGTAGTCAGTATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016056.1-989s1c1
Sequence:CCGGCTTGATTTAGGATCTCAGTTACTCGAGTAACTGAGATCCTAAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016056.1-397s1c1
Sequence:CCGGGCAGTTGTTGTTACTTTCTATCTCGAGATAGAAAGTAACAACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016056
VALIDATED
TMBIM4 MISSION shRNA Lentiviral Transduction Particles
transmembrane BAX inhibitor motif containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016056.2-867s21c1
Sequence:CCGGGCAGTATATAGAAACTGTTTCCTCGAGGAAACAGTTTCTATATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016056.2-668s21c1
Sequence:CCGGACACACTCACTGATGCATAAACTCGAGTTTATGCATCAGTGAGTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016056.2-603s21c1
Sequence:CCGGAGATAATGGAGTTGGTCTTAGCTCGAGCTAAGACCAACTCCATTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016056.1-256s1c1
Sequence:CCGGGTACATGAGAGTCCTGCCTTACTCGAGTAAGGCAGGACTCTCATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016056.1-316s1c1
Sequence:CCGGGCGTTGACTTTAAACAGACATCTCGAGATGTCTGTTTAAAGTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016056.1-439s1c1
Sequence:CCGGGCTTTCATACTGACTACTACACTCGAGTGTAGTAGTCAGTATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158586    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016056.1-989s1c1
Sequence:CCGGCTTGATTTAGGATCTCAGTTACTCGAGTAACTGAGATCCTAAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016056.1-397s1c1
Sequence:CCGGGCAGTTGTTGTTACTTTCTATCTCGAGATAGAAAGTAACAACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026617
VALIDATED
TMBIM4 MISSION shRNA Bacterial Glycerol Stock
transmembrane BAX inhibitor motif containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-231s21c1
Sequence:CCGGGCCTTAATTGTGGTGTTTGCTCTCGAGAGCAAACACCACAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-439s21c1
Sequence:CCGGCCTATACTCTACAATCAAAGACTCGAGTCTTTGATTGTAGAGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-365s21c1
Sequence:CCGGTGTTACCTTCTATGATGTATACTCGAGTATACATCATAGAAGGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-298s21c1
Sequence:CCGGCGCATCCTCTGAACCTCTATCCTCGAGGATAGAGGTTCAGAGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-387s21c1
Sequence:CCGGCTGGTTCTGCAAGCGTTTATACTCGAGTATAAACGCTTGCAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026617.1-229s1c1
Sequence:CCGGCCTGCCTTAATTGTGGTGTTTCTCGAGAAACACCACAATTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026617.1-440s1c1
Sequence:CCGGCCTATACTCTACAATCAAAGACTCGAGTCTTTGATTGTAGAGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026617.1-232s1c1
Sequence:CCGGGCCTTAATTGTGGTGTTTGCTCTCGAGAGCAAACACCACAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026617.1-205s1c1
Sequence:CCGGCTGCGGACATTTGTCCATGAACTCGAGTTCATGGACAAATGTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026617.1-446s1c1
Sequence:CCGGCTCTACAATCAAAGAGAGATTCTCGAGAATCTCTCTTTGATTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026617
VALIDATED
TMBIM4 MISSION shRNA shRNA Plasmid DNA
transmembrane BAX inhibitor motif containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-231s21c1
Sequence:CCGGGCCTTAATTGTGGTGTTTGCTCTCGAGAGCAAACACCACAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-439s21c1
Sequence:CCGGCCTATACTCTACAATCAAAGACTCGAGTCTTTGATTGTAGAGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-365s21c1
Sequence:CCGGTGTTACCTTCTATGATGTATACTCGAGTATACATCATAGAAGGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-298s21c1
Sequence:CCGGCGCATCCTCTGAACCTCTATCCTCGAGGATAGAGGTTCAGAGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-387s21c1
Sequence:CCGGCTGGTTCTGCAAGCGTTTATACTCGAGTATAAACGCTTGCAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026617.1-229s1c1
Sequence:CCGGCCTGCCTTAATTGTGGTGTTTCTCGAGAAACACCACAATTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026617.1-440s1c1
Sequence:CCGGCCTATACTCTACAATCAAAGACTCGAGTCTTTGATTGTAGAGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026617.1-232s1c1
Sequence:CCGGGCCTTAATTGTGGTGTTTGCTCTCGAGAGCAAACACCACAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026617.1-205s1c1
Sequence:CCGGCTGCGGACATTTGTCCATGAACTCGAGTTCATGGACAAATGTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026617.1-446s1c1
Sequence:CCGGCTCTACAATCAAAGAGAGATTCTCGAGAATCTCTCTTTGATTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026617
VALIDATED
TMBIM4 MISSION shRNA Lentiviral Transduction Particles
transmembrane BAX inhibitor motif containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-231s21c1
Sequence:CCGGGCCTTAATTGTGGTGTTTGCTCTCGAGAGCAAACACCACAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-439s21c1
Sequence:CCGGCCTATACTCTACAATCAAAGACTCGAGTCTTTGATTGTAGAGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-365s21c1
Sequence:CCGGTGTTACCTTCTATGATGTATACTCGAGTATACATCATAGAAGGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-298s21c1
Sequence:CCGGCGCATCCTCTGAACCTCTATCCTCGAGGATAGAGGTTCAGAGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026617.3-387s21c1
Sequence:CCGGCTGGTTCTGCAAGCGTTTATACTCGAGTATAAACGCTTGCAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026617.1-229s1c1
Sequence:CCGGCCTGCCTTAATTGTGGTGTTTCTCGAGAAACACCACAATTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026617.1-440s1c1
Sequence:CCGGCCTATACTCTACAATCAAAGACTCGAGTCTTTGATTGTAGAGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026617.1-232s1c1
Sequence:CCGGGCCTTAATTGTGGTGTTTGCTCTCGAGAGCAAACACCACAATTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026617.1-205s1c1
Sequence:CCGGCTGCGGACATTTGTCCATGAACTCGAGTTCATGGACAAATGTCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026617.1-446s1c1
Sequence:CCGGCTCTACAATCAAAGAGAGATTCTCGAGAATCTCTCTTTGATTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks