EMAIL THIS PAGE TO A FRIEND

TMBIM6

transmembrane BAX inhibitor motif containing 6

Synonyms: BAXI1 BI-1 TEGT
UniProtKB ID: P55061, B2R5M4, O14938, Q643A7, Q96J50
Gene ID:
Mouse(110213) transmembrane BAX inhibitor motif containing 6
Rat(24822) transmembrane BAX inhibitor motif containing 6
domestic cat(101084551) transmembrane BAX inhibitor motif containing 6
dog(477614) transmembrane BAX inhibitor motif containing 6
naked mole-rat(101709105) transmembrane BAX inhibitor motif containing 6
domestic guinea pig(100714513) transmembrane BAX inhibitor motif containing 6
cow(616210) transmembrane BAX inhibitor motif containing 6
sheep(101122511) transmembrane BAX inhibitor motif containing 6
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055241 MISSION® esiRNA esiRNA human TMBIM6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098576 Rosetta Predictions human pricing
NM_003217 Rosetta Predictions human pricing
NM_019381 Rosetta Predictions rat pricing
NM_026669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319436 predicted 1127
2 SASI_Hs02_00319437 predicted 1325
3 SASI_Hs02_00319438 predicted 1116
4 SASI_Hs02_00319439 predicted 1089
5 SASI_Hs02_00319440 predicted 1088
6 SASI_Hs02_00319441 predicted 1661
7 SASI_Hs02_00319442 predicted 1690
8 SASI_Hs02_00319443 predicted 856
9 SASI_Hs02_00319444 predicted 848
10 SASI_Hs02_00319445 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335249 predicted 759
2 SASI_Hs01_00101306 predicted 958
3 SASI_Hs01_00101307 predicted 747
4 SASI_Hs01_00101308 predicted 710
5 SASI_Hs01_00101312 predicted 719
6 SASI_Hs02_00335250 predicted 1293
7 SASI_Hs02_00335251 predicted 1315
8 SASI_Hs02_00335252 predicted 492
9 SASI_Hs02_00335253 predicted 479
10 SASI_Hs02_00335254 predicted 472
11 SASI_Hs01_00101305 predicted 646
12 SASI_Hs01_00101309 predicted 912
13 SASI_Hs01_00101310 predicted 933
14 SASI_Hs01_00101311 predicted 832
15 SASI_Hs01_00101313 predicted 274
16 SASI_Hs01_00101314 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262415 predicted 581
2 SASI_Rn02_00262416 predicted 521
3 SASI_Rn02_00262417 predicted 640
4 SASI_Rn02_00262418 predicted 638
5 SASI_Rn02_00262419 predicted 619
6 SASI_Rn02_00262420 predicted 276
7 SASI_Rn02_00262421 predicted 629
8 SASI_Rn02_00262422 predicted 210
9 SASI_Rn02_00262423 predicted 210
10 SASI_Rn02_00262424 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021122 predicted 529
2 SASI_Mm01_00021124 predicted 266
3 SASI_Mm01_00021125 predicted 1165
4 SASI_Mm01_00021126 predicted 431
5 SASI_Mm01_00021127 predicted 209
6 SASI_Mm01_00021129 predicted 1134
7 SASI_Mm01_00021130 predicted 1057
8 SASI_Mm01_00021131 predicted 425
9 SASI_Mm02_00330669 predicted 1251
10 SASI_Mm02_00330670 predicted 1164
11 SASI_Mm01_00021123 predicted 590
12 SASI_Mm01_00021128 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003217
VALIDATED
TMBIM6 MISSION shRNA Bacterial Glycerol Stock
transmembrane BAX inhibitor motif containing 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003217.1-595s1c1
Sequence:CCGGCCTTGTTGATACTCAACTCATCTCGAGATGAGTTGAGTATCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003217.1-258s1c1
Sequence:CCGGCAACACCTCATAGCCATGAAACTCGAGTTTCATGGCTATGAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003217.1-529s1c1
Sequence:CCGGCTTTGGATCCATTTGGCCTTTCTCGAGAAAGGCCAAATGGATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003217.1-1791s1c1
Sequence:CCGGGCAGCAATCCTAATAGTCCTTCTCGAGAAGGACTATTAGGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003217.1-2161s1c1
Sequence:CCGGGCTCATTACCAGTAGGACATACTCGAGTATGTCCTACTGGTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003217.1-2148s1c1
Sequence:CCGGCGAGCCATTGAAAGCTCATTACTCGAGTAATGAGCTTTCAATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003217.1-644s1c1
Sequence:CCGGGATTATATCTGGCACTGCATTCTCGAGAATGCAGTGCCAGATATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003217.1-628s1c1
Sequence:CCGGCGAACATGGAGATCAAGATTACTCGAGTAATCTTGATCTCCATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003217.1-232s1c1
Sequence:CCGGCCTGATATTGATGATTTGGCTCTCGAGAGCCAAATCATCAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003217.2-350s21c1
Sequence:CCGGCAACACCTCATAGCCATGAAACTCGAGTTTCATGGCTATGAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003217.2-720s21c1
Sequence:CCGGCGAACATGGAGATCAAGATTACTCGAGTAATCTTGATCTCCATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003217.2-1883s21c1
Sequence:CCGGGCAGCAATCCTAATAGTCCTTCTCGAGAAGGACTATTAGGATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003217.2-736s21c1
Sequence:CCGGGATTATATCTGGCACTGCATTCTCGAGAATGCAGTGCCAGATATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003217
VALIDATED
TMBIM6 MISSION shRNA shRNA Plasmid DNA
transmembrane BAX inhibitor motif containing 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003217.1-595s1c1
Sequence:CCGGCCTTGTTGATACTCAACTCATCTCGAGATGAGTTGAGTATCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003217.1-258s1c1
Sequence:CCGGCAACACCTCATAGCCATGAAACTCGAGTTTCATGGCTATGAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003217.1-529s1c1
Sequence:CCGGCTTTGGATCCATTTGGCCTTTCTCGAGAAAGGCCAAATGGATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003217.1-1791s1c1
Sequence:CCGGGCAGCAATCCTAATAGTCCTTCTCGAGAAGGACTATTAGGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003217.1-2161s1c1
Sequence:CCGGGCTCATTACCAGTAGGACATACTCGAGTATGTCCTACTGGTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003217.1-2148s1c1
Sequence:CCGGCGAGCCATTGAAAGCTCATTACTCGAGTAATGAGCTTTCAATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003217.1-644s1c1
Sequence:CCGGGATTATATCTGGCACTGCATTCTCGAGAATGCAGTGCCAGATATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003217.1-628s1c1
Sequence:CCGGCGAACATGGAGATCAAGATTACTCGAGTAATCTTGATCTCCATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003217.1-232s1c1
Sequence:CCGGCCTGATATTGATGATTTGGCTCTCGAGAGCCAAATCATCAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003217.2-350s21c1
Sequence:CCGGCAACACCTCATAGCCATGAAACTCGAGTTTCATGGCTATGAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003217.2-720s21c1
Sequence:CCGGCGAACATGGAGATCAAGATTACTCGAGTAATCTTGATCTCCATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003217.2-1883s21c1
Sequence:CCGGGCAGCAATCCTAATAGTCCTTCTCGAGAAGGACTATTAGGATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003217.2-736s21c1
Sequence:CCGGGATTATATCTGGCACTGCATTCTCGAGAATGCAGTGCCAGATATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003217
VALIDATED
TMBIM6 MISSION shRNA Lentiviral Transduction Particles
transmembrane BAX inhibitor motif containing 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003217.1-595s1c1
Sequence:CCGGCCTTGTTGATACTCAACTCATCTCGAGATGAGTTGAGTATCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003217.1-258s1c1
Sequence:CCGGCAACACCTCATAGCCATGAAACTCGAGTTTCATGGCTATGAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003217.1-529s1c1
Sequence:CCGGCTTTGGATCCATTTGGCCTTTCTCGAGAAAGGCCAAATGGATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003217.1-1791s1c1
Sequence:CCGGGCAGCAATCCTAATAGTCCTTCTCGAGAAGGACTATTAGGATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142051    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003217.1-2161s1c1
Sequence:CCGGGCTCATTACCAGTAGGACATACTCGAGTATGTCCTACTGGTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142622    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003217.1-2148s1c1
Sequence:CCGGCGAGCCATTGAAAGCTCATTACTCGAGTAATGAGCTTTCAATGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003217.1-644s1c1
Sequence:CCGGGATTATATCTGGCACTGCATTCTCGAGAATGCAGTGCCAGATATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003217.1-628s1c1
Sequence:CCGGCGAACATGGAGATCAAGATTACTCGAGTAATCTTGATCTCCATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003217.1-232s1c1
Sequence:CCGGCCTGATATTGATGATTTGGCTCTCGAGAGCCAAATCATCAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003217.2-350s21c1
Sequence:CCGGCAACACCTCATAGCCATGAAACTCGAGTTTCATGGCTATGAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003217.2-720s21c1
Sequence:CCGGCGAACATGGAGATCAAGATTACTCGAGTAATCTTGATCTCCATGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003217.2-1883s21c1
Sequence:CCGGGCAGCAATCCTAATAGTCCTTCTCGAGAAGGACTATTAGGATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003217.2-736s21c1
Sequence:CCGGGATTATATCTGGCACTGCATTCTCGAGAATGCAGTGCCAGATATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026669
VALIDATED
TMBIM6 MISSION shRNA Bacterial Glycerol Stock
transmembrane BAX inhibitor motif containing 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026669.2-1545s1c1
Sequence:CCGGCAGGGCTAATTGTACTGAGTACTCGAGTACTCAGTACAATTAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026669.2-717s1c1
Sequence:CCGGCCTAGATTTCGTTACCCTCTTCTCGAGAAGAGGGTAACGAAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026669.2-639s1c1
Sequence:CCGGCCTCTTTGATACTCAGCTCATCTCGAGATGAGCTGAGTATCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026669.2-225s1c1
Sequence:CCGGCCATGTGGTCACACACTTCATCTCGAGATGAAGTGTGTGACCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026669.2-710s1c1
Sequence:CCGGACCTCTTCCTAGATTTCGTTACTCGAGTAACGAAATCTAGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026669.3-875s21c1
Sequence:CCGGGTGTCGTGTTCTATGATAATGCTCGAGCATTATCATAGAACACGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026669.3-224s21c1
Sequence:CCGGCCATGTGGTCACACACTTCATCTCGAGATGAAGTGTGTGACCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026669.3-147s21c1
Sequence:CCGGTCGACACAGCAGCACCTAAAGCTCGAGCTTTAGGTGCTGCTGTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026669.3-665s21c1
Sequence:CCGGGAAGGCTGAACACGGAGATAACTCGAGTTATCTCCGTGTTCAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026669.3-709s21c1
Sequence:CCGGACCTCTTCCTAGATTTCGTTACTCGAGTAACGAAATCTAGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026669
VALIDATED
TMBIM6 MISSION shRNA shRNA Plasmid DNA
transmembrane BAX inhibitor motif containing 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026669.2-1545s1c1
Sequence:CCGGCAGGGCTAATTGTACTGAGTACTCGAGTACTCAGTACAATTAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026669.2-717s1c1
Sequence:CCGGCCTAGATTTCGTTACCCTCTTCTCGAGAAGAGGGTAACGAAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026669.2-639s1c1
Sequence:CCGGCCTCTTTGATACTCAGCTCATCTCGAGATGAGCTGAGTATCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026669.2-225s1c1
Sequence:CCGGCCATGTGGTCACACACTTCATCTCGAGATGAAGTGTGTGACCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026669.2-710s1c1
Sequence:CCGGACCTCTTCCTAGATTTCGTTACTCGAGTAACGAAATCTAGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026669.3-875s21c1
Sequence:CCGGGTGTCGTGTTCTATGATAATGCTCGAGCATTATCATAGAACACGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026669.3-224s21c1
Sequence:CCGGCCATGTGGTCACACACTTCATCTCGAGATGAAGTGTGTGACCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026669.3-147s21c1
Sequence:CCGGTCGACACAGCAGCACCTAAAGCTCGAGCTTTAGGTGCTGCTGTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026669.3-665s21c1
Sequence:CCGGGAAGGCTGAACACGGAGATAACTCGAGTTATCTCCGTGTTCAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026669.3-709s21c1
Sequence:CCGGACCTCTTCCTAGATTTCGTTACTCGAGTAACGAAATCTAGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026669
VALIDATED
TMBIM6 MISSION shRNA Lentiviral Transduction Particles
transmembrane BAX inhibitor motif containing 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026669.2-1545s1c1
Sequence:CCGGCAGGGCTAATTGTACTGAGTACTCGAGTACTCAGTACAATTAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026669.2-717s1c1
Sequence:CCGGCCTAGATTTCGTTACCCTCTTCTCGAGAAGAGGGTAACGAAATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026669.2-639s1c1
Sequence:CCGGCCTCTTTGATACTCAGCTCATCTCGAGATGAGCTGAGTATCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026669.2-225s1c1
Sequence:CCGGCCATGTGGTCACACACTTCATCTCGAGATGAAGTGTGTGACCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026669.2-710s1c1
Sequence:CCGGACCTCTTCCTAGATTTCGTTACTCGAGTAACGAAATCTAGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026669.3-875s21c1
Sequence:CCGGGTGTCGTGTTCTATGATAATGCTCGAGCATTATCATAGAACACGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026669.3-224s21c1
Sequence:CCGGCCATGTGGTCACACACTTCATCTCGAGATGAAGTGTGTGACCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026669.3-147s21c1
Sequence:CCGGTCGACACAGCAGCACCTAAAGCTCGAGCTTTAGGTGCTGCTGTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026669.3-665s21c1
Sequence:CCGGGAAGGCTGAACACGGAGATAACTCGAGTTATCTCCGTGTTCAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026669.3-709s21c1
Sequence:CCGGACCTCTTCCTAGATTTCGTTACTCGAGTAACGAAATCTAGGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks