EMAIL THIS PAGE TO A FRIEND

TMC1

transmembrane channel-like 1

Synonyms: DFNA36 DFNB11 DFNB7
UniProtKB ID: Q8TDI8, A8MVZ2, B1AM91
Gene ID:
Human(117531) Summary: This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
Mouse(13409) transmembrane channel-like gene family 1
Rat(361739) transmembrane channel-like 1
Zebrafish(567237) transmembrane channel-like 1
dog(484168) transmembrane channel-like 1
domestic cat(101091314) transmembrane channel-like 1
chicken(427255) transmembrane channel-like 1
cow(538406) transmembrane channel-like 1
sheep(101114592) transmembrane channel-like 1
domestic guinea pig(100732025) transmembrane channel-like 1
Domestic Rabbit(100359097) transmembrane channel-like 1
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138691 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138691 Rosetta Predictions human pricing
NM_001108521 Rosetta Predictions rat pricing
NM_028953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363784 predicted 1803
2 SASI_Hs01_00186528 predicted 1957
3 SASI_Hs02_00363785 predicted 1156
4 SASI_Hs01_00186529 predicted 1889
5 SASI_Hs01_00186530 predicted 2158
6 SASI_Hs01_00186532 predicted 2006
7 SASI_Hs01_00186533 predicted 2668
8 SASI_Hs01_00186536 predicted 1116
9 SASI_Hs01_00186537 predicted 2441
10 SASI_Hs02_00363786 predicted 1244
11 SASI_Hs01_00186531 predicted 1129
12 SASI_Hs01_00186534 predicted 1539
13 SASI_Hs01_00186535 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239469 predicted 940
2 SASI_Rn02_00239470 predicted 694
3 SASI_Rn02_00239471 predicted 2112
4 SASI_Rn02_00239472 predicted 1001
5 SASI_Rn02_00239473 predicted 1547
6 SASI_Rn02_00239474 predicted 1052
7 SASI_Rn02_00239475 predicted 1581
8 SASI_Rn02_00239476 predicted 1772
9 SASI_Rn02_00239477 predicted 560
10 SASI_Rn02_00239478 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167721 predicted 850
2 SASI_Mm01_00167722 predicted 1840
3 SASI_Mm01_00167723 predicted 1130
4 SASI_Mm01_00167724 predicted 764
5 SASI_Mm02_00334679 predicted 1544
6 SASI_Mm01_00167725 predicted 1824
7 SASI_Mm01_00167726 predicted 1942
8 SASI_Mm01_00167727 predicted 1590
9 SASI_Mm01_00167728 predicted 1791
10 SASI_Mm02_00334680 predicted 1151
11 SASI_Mm01_00167720 predicted 1525
12 SASI_Mm01_00167729 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138691
TMC1 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138691.2-2806s21c1
Sequence:CCGGGCTGCTGGTCGCCAGTAATAACTCGAGTTATTACTGGCGACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138691.2-1958s21c1
Sequence:CCGGAGCTAGTAAAGGCCAATATTACTCGAGTAATATTGGCCTTTACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138691.2-2215s21c1
Sequence:CCGGTGGGACTTGGAGTATGGATATCTCGAGATATCCATACTCCAAGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138691.2-2952s21c1
Sequence:CCGGAGGTCATGCTGGCCAATTAAGCTCGAGCTTAATTGGCCAGCATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-670s1c1
Sequence:CCGGCGGACCAGAGATGTTATCAATCTCGAGATTGATAACATCTCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-2383s1c1
Sequence:CCGGGCCGTTATGTGCTGCAATGTTCTCGAGAACATTGCAGCACATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-1822s1c1
Sequence:CCGGGCTGAATTAGAAGACTACCATCTCGAGATGGTAGTCTTCTAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-2675s1c1
Sequence:CCGGCCATCTATTATCTCAATGCTACTCGAGTAGCATTGAGATAATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-1642s1c1
Sequence:CCGGGCTAACTTCTTCGTGTTTCTACTCGAGTAGAAACACGAAGAAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138691
TMC1 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138691.2-2806s21c1
Sequence:CCGGGCTGCTGGTCGCCAGTAATAACTCGAGTTATTACTGGCGACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138691.2-1958s21c1
Sequence:CCGGAGCTAGTAAAGGCCAATATTACTCGAGTAATATTGGCCTTTACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138691.2-2215s21c1
Sequence:CCGGTGGGACTTGGAGTATGGATATCTCGAGATATCCATACTCCAAGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138691.2-2952s21c1
Sequence:CCGGAGGTCATGCTGGCCAATTAAGCTCGAGCTTAATTGGCCAGCATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-670s1c1
Sequence:CCGGCGGACCAGAGATGTTATCAATCTCGAGATTGATAACATCTCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-2383s1c1
Sequence:CCGGGCCGTTATGTGCTGCAATGTTCTCGAGAACATTGCAGCACATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-1822s1c1
Sequence:CCGGGCTGAATTAGAAGACTACCATCTCGAGATGGTAGTCTTCTAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-2675s1c1
Sequence:CCGGCCATCTATTATCTCAATGCTACTCGAGTAGCATTGAGATAATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-1642s1c1
Sequence:CCGGGCTAACTTCTTCGTGTTTCTACTCGAGTAGAAACACGAAGAAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138691
TMC1 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138691.2-2806s21c1
Sequence:CCGGGCTGCTGGTCGCCAGTAATAACTCGAGTTATTACTGGCGACCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138691.2-1958s21c1
Sequence:CCGGAGCTAGTAAAGGCCAATATTACTCGAGTAATATTGGCCTTTACTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138691.2-2215s21c1
Sequence:CCGGTGGGACTTGGAGTATGGATATCTCGAGATATCCATACTCCAAGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138691.2-2952s21c1
Sequence:CCGGAGGTCATGCTGGCCAATTAAGCTCGAGCTTAATTGGCCAGCATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-670s1c1
Sequence:CCGGCGGACCAGAGATGTTATCAATCTCGAGATTGATAACATCTCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-2383s1c1
Sequence:CCGGGCCGTTATGTGCTGCAATGTTCTCGAGAACATTGCAGCACATAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-1822s1c1
Sequence:CCGGGCTGAATTAGAAGACTACCATCTCGAGATGGTAGTCTTCTAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-2675s1c1
Sequence:CCGGCCATCTATTATCTCAATGCTACTCGAGTAGCATTGAGATAATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138691.2-1642s1c1
Sequence:CCGGGCTAACTTCTTCGTGTTTCTACTCGAGTAGAAACACGAAGAAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028953
TMC1 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-769s1c1
Sequence:CCGGCCTCATCATGTTACCGGAGTACTCGAGTACTCCGGTAACATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-1827s1c1
Sequence:CCGGGCTGGGACTTAGAATATGGATCTCGAGATCCATATTCTAAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-2284s1c1
Sequence:CCGGCCTGACCATCTATTATCTCAACTCGAGTTGAGATAATAGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-1277s1c1
Sequence:CCGGGCAAGTGGATACCTCATCTTTCTCGAGAAAGATGAGGTATCCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-272s1c1
Sequence:CCGGCGGACCAGAGATGTCATCAATCTCGAGATTGATGACATCTCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028953
TMC1 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-769s1c1
Sequence:CCGGCCTCATCATGTTACCGGAGTACTCGAGTACTCCGGTAACATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-1827s1c1
Sequence:CCGGGCTGGGACTTAGAATATGGATCTCGAGATCCATATTCTAAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-2284s1c1
Sequence:CCGGCCTGACCATCTATTATCTCAACTCGAGTTGAGATAATAGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-1277s1c1
Sequence:CCGGGCAAGTGGATACCTCATCTTTCTCGAGAAAGATGAGGTATCCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-272s1c1
Sequence:CCGGCGGACCAGAGATGTCATCAATCTCGAGATTGATGACATCTCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028953
TMC1 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-769s1c1
Sequence:CCGGCCTCATCATGTTACCGGAGTACTCGAGTACTCCGGTAACATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-1827s1c1
Sequence:CCGGGCTGGGACTTAGAATATGGATCTCGAGATCCATATTCTAAGTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-2284s1c1
Sequence:CCGGCCTGACCATCTATTATCTCAACTCGAGTTGAGATAATAGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-1277s1c1
Sequence:CCGGGCAAGTGGATACCTCATCTTTCTCGAGAAAGATGAGGTATCCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028953.1-272s1c1
Sequence:CCGGCGGACCAGAGATGTCATCAATCTCGAGATTGATGACATCTCTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks