EMAIL THIS PAGE TO A FRIEND

TMC2

transmembrane channel-like 2

Synonyms: C20orf145 dJ686C3.3
Gene ID:
Human(117532) Summary: This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, expression in the inner ear suggests that it may be crucial for normal auditory function. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Jul 2008]
Mouse(192140) transmembrane channel-like gene family 2
Rat(296153) transmembrane channel-like 2
cow(515300) transmembrane channel-like 2
sheep(101104516) transmembrane channel-like 2
Domestic Rabbit(100352489) transmembrane channel-like 2
naked mole-rat(101722958) transmembrane channel-like 2
domestic guinea pig(100718243) transmembrane channel-like 2
chicken(428456) transmembrane channel-like 2
Horse(100067097) transmembrane channel-like 2
domestic cat(101083256) transmembrane channel-like 2
dog(477179) transmembrane channel-like 2
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50271 Anti-TMC2 antibody produced in rabbit affinity isolated antibody horse, rat, human, mouse, rabbit, zebrafish, guinea pig
western blot pricing
HPA046350 Anti-TMC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080751 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066001 MISSION® esiRNA esiRNA human TMC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080751 Rosetta Predictions human pricing
NM_001106510 Rosetta Predictions rat pricing
NM_138655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026791 predicted 1890
2 SASI_Hs01_00026792 predicted 1398
3 SASI_Hs01_00026793 predicted 1897
4 SASI_Hs01_00026794 predicted 1179
5 SASI_Hs01_00026795 predicted 592
6 SASI_Hs01_00026796 predicted 794
7 SASI_Hs01_00026797 predicted 1067
8 SASI_Hs01_00026798 predicted 1353
9 SASI_Hs01_00026799 predicted 1985
10 SASI_Hs01_00026800 predicted 2453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219678 predicted 840
2 SASI_Rn02_00219679 predicted 1803
3 SASI_Rn02_00219680 predicted 1444
4 SASI_Rn02_00219681 predicted 1098
5 SASI_Rn02_00219682 predicted 1946
6 SASI_Rn02_00219683 predicted 1461
7 SASI_Rn02_00219684 predicted 2253
8 SASI_Rn02_00219685 predicted 1956
9 SASI_Rn02_00219686 predicted 2410
10 SASI_Rn02_00219687 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195947 predicted 1998
2 SASI_Mm01_00195948 predicted 904
3 SASI_Mm01_00195949 predicted 1041
4 SASI_Mm01_00195950 predicted 2145
5 SASI_Mm02_00339714 predicted 1892
6 SASI_Mm01_00195951 predicted 2633
7 SASI_Mm01_00195952 predicted 2561
8 SASI_Mm01_00195953 predicted 726
9 SASI_Mm01_00195954 predicted 1665
10 SASI_Mm01_00195956 predicted 986
11 SASI_Mm01_00195955 predicted 2504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138655
TMC2 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-1035s1c1
Sequence:CCGGCCGATGGATGTATGGAGTTAACTCGAGTTAACTCCATACATCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-2744s1c1
Sequence:CCGGCCACCCAGATACATCTTACTACTCGAGTAGTAAGATGTATCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-2150s1c1
Sequence:CCGGCCGAGTTTGATATTAGTGGAACTCGAGTTCCACTAATATCAAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-907s1c1
Sequence:CCGGGCTAAGAAATGGGTCAAGTTTCTCGAGAAACTTGACCCATTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-2040s1c1
Sequence:CCGGGCTGGTAACATACCTCACCATCTCGAGATGGTGAGGTATGTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138655
TMC2 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-1035s1c1
Sequence:CCGGCCGATGGATGTATGGAGTTAACTCGAGTTAACTCCATACATCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-2744s1c1
Sequence:CCGGCCACCCAGATACATCTTACTACTCGAGTAGTAAGATGTATCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-2150s1c1
Sequence:CCGGCCGAGTTTGATATTAGTGGAACTCGAGTTCCACTAATATCAAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-907s1c1
Sequence:CCGGGCTAAGAAATGGGTCAAGTTTCTCGAGAAACTTGACCCATTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-2040s1c1
Sequence:CCGGGCTGGTAACATACCTCACCATCTCGAGATGGTGAGGTATGTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138655
TMC2 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-1035s1c1
Sequence:CCGGCCGATGGATGTATGGAGTTAACTCGAGTTAACTCCATACATCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-2744s1c1
Sequence:CCGGCCACCCAGATACATCTTACTACTCGAGTAGTAAGATGTATCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-2150s1c1
Sequence:CCGGCCGAGTTTGATATTAGTGGAACTCGAGTTCCACTAATATCAAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-907s1c1
Sequence:CCGGGCTAAGAAATGGGTCAAGTTTCTCGAGAAACTTGACCCATTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138655.1-2040s1c1
Sequence:CCGGGCTGGTAACATACCTCACCATCTCGAGATGGTGAGGTATGTTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080751
TMC2 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-1022s1c1
Sequence:CCGGGCCTGATTATTGTCATTCGATCTCGAGATCGAATGACAATAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-2034s1c1
Sequence:CCGGCCGATCCAACAACTTCTACATCTCGAGATGTAGAAGTTGTTGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-1305s1c1
Sequence:CCGGCCTCATTTACTTTGTGGTTAACTCGAGTTAACCACAAAGTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080751.1-2916s1c1
Sequence:CCGGGCCCTCCCAAATATCTTGGTTCTCGAGAACCAAGATATTTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-579s1c1
Sequence:CCGGGCAACTATATGCCTACAAGATCTCGAGATCTTGTAGGCATATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080751
TMC2 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-1022s1c1
Sequence:CCGGGCCTGATTATTGTCATTCGATCTCGAGATCGAATGACAATAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-2034s1c1
Sequence:CCGGCCGATCCAACAACTTCTACATCTCGAGATGTAGAAGTTGTTGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-1305s1c1
Sequence:CCGGCCTCATTTACTTTGTGGTTAACTCGAGTTAACCACAAAGTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080751.1-2916s1c1
Sequence:CCGGGCCCTCCCAAATATCTTGGTTCTCGAGAACCAAGATATTTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-579s1c1
Sequence:CCGGGCAACTATATGCCTACAAGATCTCGAGATCTTGTAGGCATATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080751
TMC2 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-1022s1c1
Sequence:CCGGGCCTGATTATTGTCATTCGATCTCGAGATCGAATGACAATAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-2034s1c1
Sequence:CCGGCCGATCCAACAACTTCTACATCTCGAGATGTAGAAGTTGTTGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-1305s1c1
Sequence:CCGGCCTCATTTACTTTGTGGTTAACTCGAGTTAACCACAAAGTAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080751.1-2916s1c1
Sequence:CCGGGCCCTCCCAAATATCTTGGTTCTCGAGAACCAAGATATTTGGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080751.1-579s1c1
Sequence:CCGGGCAACTATATGCCTACAAGATCTCGAGATCTTGTAGGCATATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks