EMAIL THIS PAGE TO A FRIEND

TMC3

transmembrane channel-like 3

UniProtKB ID: Q7Z5M5, A2RTY2, B2RXJ3, Q7Z405
Gene ID:
Mouse(233424) transmembrane channel-like gene family 3
Rat(293065) transmembrane channel-like 3
chicken(415470) transmembrane channel-like 3
domestic cat(101087997) transmembrane channel-like 3
Horse(100067204) transmembrane channel-like 3
dog(488760) transmembrane channel-like 3
domestic guinea pig(100721730) transmembrane channel-like 3
naked mole-rat(101698257) transmembrane channel-like 3
Domestic Rabbit(100355089) transmembrane channel-like 3
cow(519031) transmembrane channel-like 3
sheep(101117450) transmembrane channel-like 3
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181841 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065891 MISSION® esiRNA esiRNA targeting mouse Tmc3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080532 Rosetta Predictions human pricing
XM_930010 Rosetta Predictions human pricing
XM_001068203 Rosetta Predictions rat pricing
XM_218848 Rosetta Predictions rat pricing
NM_177695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315757 predicted 333
2 SASI_Hs02_00315758 predicted 2155
3 SASI_Hs02_00315759 predicted 1912
4 SASI_Hs02_00315760 predicted 698
5 SASI_Hs02_00315761 predicted 226
6 SASI_Hs02_00315762 predicted 1042
7 SASI_Hs02_00315763 predicted 1862
8 SASI_Hs02_00315764 predicted 1298
9 SASI_Hs02_00315765 predicted 2510
10 SASI_Hs02_00315766 predicted 2428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265963 predicted 1091
2 SASI_Hs01_00265964 predicted 1057
3 SASI_Hs01_00265965 predicted 994
4 SASI_Hs01_00265966 predicted 1044
5 SASI_Hs01_00265967 predicted 1125
6 SASI_Hs01_00265968 predicted 960
7 SASI_Hs01_00265969 predicted 996
8 SASI_Hs01_00265970 predicted 991
9 SASI_Hs01_00265971 predicted 1059
10 SASI_Hs01_00265972 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323815 predicted 1616
2 SASI_Rn02_00323816 predicted 332
3 SASI_Rn02_00323817 predicted 2832
4 SASI_Rn02_00323818 predicted 237
5 SASI_Rn02_00323819 predicted 1746
6 SASI_Rn02_00323820 predicted 2809
7 SASI_Rn02_00323821 predicted 2823
8 SASI_Rn02_00323822 predicted 1644
9 SASI_Rn02_00323823 predicted 2242
10 SASI_Rn02_00323824 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378132 predicted 2833
2 SASI_Rn02_00378133 predicted 3046
3 SASI_Rn02_00378134 predicted 2575
4 SASI_Rn02_00378135 predicted 2739
5 SASI_Rn02_00378136 predicted 2810
6 SASI_Rn02_00378137 predicted 3100
7 SASI_Rn02_00378138 predicted 2821
8 SASI_Rn02_00378139 predicted 2956
9 SASI_Rn02_00378140 predicted 3039
10 SASI_Rn02_00378141 predicted 2853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056036 predicted 2020
2 SASI_Mm01_00056037 predicted 498
3 SASI_Mm02_00348037 predicted 3640
4 SASI_Mm02_00348038 predicted 3513
5 SASI_Mm01_00056039 predicted 1608
6 SASI_Mm01_00056040 predicted 2734
7 SASI_Mm01_00056041 predicted 372
8 SASI_Mm01_00056042 predicted 2905
9 SASI_Mm01_00056043 predicted 2178
10 SASI_Mm02_00348039 predicted 2715
11 SASI_Mm01_00056038 predicted 1649
12 SASI_Mm01_00056044 predicted 1647
13 SASI_Mm01_00056045 predicted 1666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181841
TMC3 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-375s1c1
Sequence:CCGGCGCCTGTAACTTTGTGGTCATCTCGAGATGACCACAAAGTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-990s1c1
Sequence:CCGGCCTGAGGATTATTGCCAACATCTCGAGATGTTGGCAATAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-2639s1c1
Sequence:CCGGCGCGCACACCTATGACATTTACTCGAGTAAATGTCATAGGTGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-2200s1c1
Sequence:CCGGGCAAGATCAGAGGATAAGAAACTCGAGTTTCTTATCCTCTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-1479s1c1
Sequence:CCGGGCCTCTTATAAAGGCCAACAACTCGAGTTGTTGGCCTTTATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181841
TMC3 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-375s1c1
Sequence:CCGGCGCCTGTAACTTTGTGGTCATCTCGAGATGACCACAAAGTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-990s1c1
Sequence:CCGGCCTGAGGATTATTGCCAACATCTCGAGATGTTGGCAATAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-2639s1c1
Sequence:CCGGCGCGCACACCTATGACATTTACTCGAGTAAATGTCATAGGTGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-2200s1c1
Sequence:CCGGGCAAGATCAGAGGATAAGAAACTCGAGTTTCTTATCCTCTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-1479s1c1
Sequence:CCGGGCCTCTTATAAAGGCCAACAACTCGAGTTGTTGGCCTTTATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181841
TMC3 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-375s1c1
Sequence:CCGGCGCCTGTAACTTTGTGGTCATCTCGAGATGACCACAAAGTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-990s1c1
Sequence:CCGGCCTGAGGATTATTGCCAACATCTCGAGATGTTGGCAATAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-2639s1c1
Sequence:CCGGCGCGCACACCTATGACATTTACTCGAGTAAATGTCATAGGTGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-2200s1c1
Sequence:CCGGGCAAGATCAGAGGATAAGAAACTCGAGTTTCTTATCCTCTGATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181841.1-1479s1c1
Sequence:CCGGGCCTCTTATAAAGGCCAACAACTCGAGTTGTTGGCCTTTATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177695
TMC3 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-606s1c1
Sequence:CCGGCCTTCAATACTCCGTCCTGTTCTCGAGAACAGGACGGAGTATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-1443s1c1
Sequence:CCGGGCCACATACAAAGGCCAACAACTCGAGTTGTTGGCCTTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-2743s1c1
Sequence:CCGGCCCAGGTACTATGTGGTTAATCTCGAGATTAACCACATAGTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-2363s1c1
Sequence:CCGGCCTCAGTGTATATGGCAACATCTCGAGATGTTGCCATATACACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-153s1c1
Sequence:CCGGCCAGAATATACAGTTTCAGAACTCGAGTTCTGAAACTGTATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177695
TMC3 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-606s1c1
Sequence:CCGGCCTTCAATACTCCGTCCTGTTCTCGAGAACAGGACGGAGTATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-1443s1c1
Sequence:CCGGGCCACATACAAAGGCCAACAACTCGAGTTGTTGGCCTTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-2743s1c1
Sequence:CCGGCCCAGGTACTATGTGGTTAATCTCGAGATTAACCACATAGTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-2363s1c1
Sequence:CCGGCCTCAGTGTATATGGCAACATCTCGAGATGTTGCCATATACACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-153s1c1
Sequence:CCGGCCAGAATATACAGTTTCAGAACTCGAGTTCTGAAACTGTATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177695
TMC3 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-606s1c1
Sequence:CCGGCCTTCAATACTCCGTCCTGTTCTCGAGAACAGGACGGAGTATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-1443s1c1
Sequence:CCGGGCCACATACAAAGGCCAACAACTCGAGTTGTTGGCCTTTGTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-2743s1c1
Sequence:CCGGCCCAGGTACTATGTGGTTAATCTCGAGATTAACCACATAGTACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-2363s1c1
Sequence:CCGGCCTCAGTGTATATGGCAACATCTCGAGATGTTGCCATATACACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177695.3-153s1c1
Sequence:CCGGCCAGAATATACAGTTTCAGAACTCGAGTTCTGAAACTGTATATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks