EMAIL THIS PAGE TO A FRIEND

TMC4

transmembrane channel-like 4

UniProtKB ID: Q7Z404, Q7Z5M3, Q8N5E4, Q8TBS7
Gene ID:
Mouse(353499) transmembrane channel-like gene family 4
Rat(308310) transmembrane channel-like 4
cow(512610) transmembrane channel-like 4
sheep(101107548) transmembrane channel-like 4
naked mole-rat(101725253) transmembrane channel-like 4
domestic guinea pig(100729335) transmembrane channel-like 4
Zebrafish(100333974) transmembrane channel-like 4
dog(484311) transmembrane channel-like 4
Horse(100052639) transmembrane channel-like 4
domestic cat(101083126) transmembrane channel-like 4
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144686 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006651 MISSION® esiRNA esiRNA targeting mouse Tmc4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144686 Rosetta Predictions human pricing
NM_001034104 Rosetta Predictions rat pricing
NM_181820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091035 predicted 1272
2 SASI_Hs02_00364590 predicted 1450
3 SASI_Hs02_00364591 predicted 954
4 SASI_Hs02_00364592 predicted 2080
5 SASI_Hs01_00091036 predicted 1909
6 SASI_Hs02_00364593 predicted 1348
7 SASI_Hs01_00091038 predicted 1420
8 SASI_Hs01_00091039 predicted 1044
9 SASI_Hs01_00091042 predicted 1856
10 SASI_Hs01_00091043 predicted 789
11 SASI_Hs01_00091037 predicted 1945
12 SASI_Hs01_00091040 predicted 1441
13 SASI_Hs01_00091041 predicted 1484
14 SASI_Hs01_00091044 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098325 predicted 391
2 SASI_Rn01_00098327 predicted 584
3 SASI_Rn01_00098328 predicted 1007
4 SASI_Rn01_00098329 predicted 771
5 SASI_Rn01_00098330 predicted 1147
6 SASI_Rn01_00098331 predicted 203
7 SASI_Rn01_00098332 predicted 821
8 SASI_Rn01_00098333 predicted 1224
9 SASI_Rn01_00098334 predicted 1632
10 SASI_Rn02_00203939 predicted 447
11 SASI_Rn01_00098326 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118905 predicted 853
2 SASI_Mm01_00118906 predicted 1522
3 SASI_Mm01_00118907 predicted 269
4 SASI_Mm01_00118908 predicted 1291
5 SASI_Mm01_00118911 predicted 1919
6 SASI_Mm01_00118912 predicted 1246
7 SASI_Mm02_00349934 predicted 805
8 SASI_Mm01_00118913 predicted 1267
9 SASI_Mm01_00118914 predicted 614
10 SASI_Mm02_00349935 predicted 1298
11 SASI_Mm01_00118909 predicted 1638
12 SASI_Mm01_00118910 predicted 1382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181820
TMC4 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181820.1-2155s1c1
Sequence:CCGGCCTCAGCTTCAGTGACTTCATCTCGAGATGAAGTCACTGAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-1687s1c1
Sequence:CCGGCCTGAAGAAGATAACCCTCTTCTCGAGAAGAGGGTTATCTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-1214s1c1
Sequence:CCGGCCTCCTGTGTTCAAGTTCATTCTCGAGAATGAACTTGAACACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-228s1c1
Sequence:CCGGCCTTTGCAGAAACTGCACAAACTCGAGTTTGTGCAGTTTCTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-703s1c1
Sequence:CCGGCCCTCTATTCTATGGGTTCTACTCGAGTAGAACCCATAGAATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181820.2-1269s21c1
Sequence:CCGGACTAGAGGGCTACACTCAAAGCTCGAGCTTTGAGTGTAGCCCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181820.2-2066s21c1
Sequence:CCGGCTGAGCTCAAACGCCAGATAGCTCGAGCTATCTGGCGTTTGAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181820.2-1409s21c1
Sequence:CCGGGCAAGGCCTGCGGCTATAATTCTCGAGAATTATAGCCGCAGGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181820
TMC4 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181820.1-2155s1c1
Sequence:CCGGCCTCAGCTTCAGTGACTTCATCTCGAGATGAAGTCACTGAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-1687s1c1
Sequence:CCGGCCTGAAGAAGATAACCCTCTTCTCGAGAAGAGGGTTATCTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-1214s1c1
Sequence:CCGGCCTCCTGTGTTCAAGTTCATTCTCGAGAATGAACTTGAACACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-228s1c1
Sequence:CCGGCCTTTGCAGAAACTGCACAAACTCGAGTTTGTGCAGTTTCTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-703s1c1
Sequence:CCGGCCCTCTATTCTATGGGTTCTACTCGAGTAGAACCCATAGAATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181820.2-1269s21c1
Sequence:CCGGACTAGAGGGCTACACTCAAAGCTCGAGCTTTGAGTGTAGCCCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181820.2-2066s21c1
Sequence:CCGGCTGAGCTCAAACGCCAGATAGCTCGAGCTATCTGGCGTTTGAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181820.2-1409s21c1
Sequence:CCGGGCAAGGCCTGCGGCTATAATTCTCGAGAATTATAGCCGCAGGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181820
TMC4 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181820.1-2155s1c1
Sequence:CCGGCCTCAGCTTCAGTGACTTCATCTCGAGATGAAGTCACTGAAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-1687s1c1
Sequence:CCGGCCTGAAGAAGATAACCCTCTTCTCGAGAAGAGGGTTATCTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-1214s1c1
Sequence:CCGGCCTCCTGTGTTCAAGTTCATTCTCGAGAATGAACTTGAACACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-228s1c1
Sequence:CCGGCCTTTGCAGAAACTGCACAAACTCGAGTTTGTGCAGTTTCTGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181820.1-703s1c1
Sequence:CCGGCCCTCTATTCTATGGGTTCTACTCGAGTAGAACCCATAGAATAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181820.2-1269s21c1
Sequence:CCGGACTAGAGGGCTACACTCAAAGCTCGAGCTTTGAGTGTAGCCCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181820.2-2066s21c1
Sequence:CCGGCTGAGCTCAAACGCCAGATAGCTCGAGCTATCTGGCGTTTGAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181820.2-1409s21c1
Sequence:CCGGGCAAGGCCTGCGGCTATAATTCTCGAGAATTATAGCCGCAGGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144686
TMC4 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-962s1c1
Sequence:CCGGCGCATCATCTTGTACGAATTACTCGAGTAATTCGTACAAGATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-1681s1c1
Sequence:CCGGCCTGCTTAACACGGTCAAGTTCTCGAGAACTTGACCGTGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-2139s1c1
Sequence:CCGGCCTCCACCAAACCGGCTCTTTCTCGAGAAAGAGCCGGTTTGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-1911s1c1
Sequence:CCGGCCCAGATCCCTGAGTCTATTTCTCGAGAAATAGACTCAGGGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-1357s1c1
Sequence:CCGGCTTCTCTCTCTGGAATCAGATCTCGAGATCTGATTCCAGAGAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144686.2-615s21c1
Sequence:CCGGGCGCTTCCTGCTCCTTCTTAACTCGAGTTAAGAAGGAGCAGGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144686.2-2355s21c1
Sequence:CCAGAGCTTTGGTATCTGGAGATTTCTCGAGAAATCTCCAGATACCAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144686
TMC4 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-962s1c1
Sequence:CCGGCGCATCATCTTGTACGAATTACTCGAGTAATTCGTACAAGATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-1681s1c1
Sequence:CCGGCCTGCTTAACACGGTCAAGTTCTCGAGAACTTGACCGTGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-2139s1c1
Sequence:CCGGCCTCCACCAAACCGGCTCTTTCTCGAGAAAGAGCCGGTTTGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-1911s1c1
Sequence:CCGGCCCAGATCCCTGAGTCTATTTCTCGAGAAATAGACTCAGGGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-1357s1c1
Sequence:CCGGCTTCTCTCTCTGGAATCAGATCTCGAGATCTGATTCCAGAGAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144686.2-615s21c1
Sequence:CCGGGCGCTTCCTGCTCCTTCTTAACTCGAGTTAAGAAGGAGCAGGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144686.2-2355s21c1
Sequence:CCAGAGCTTTGGTATCTGGAGATTTCTCGAGAAATCTCCAGATACCAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144686
TMC4 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-962s1c1
Sequence:CCGGCGCATCATCTTGTACGAATTACTCGAGTAATTCGTACAAGATGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-1681s1c1
Sequence:CCGGCCTGCTTAACACGGTCAAGTTCTCGAGAACTTGACCGTGTTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-2139s1c1
Sequence:CCGGCCTCCACCAAACCGGCTCTTTCTCGAGAAAGAGCCGGTTTGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-1911s1c1
Sequence:CCGGCCCAGATCCCTGAGTCTATTTCTCGAGAAATAGACTCAGGGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144686.1-1357s1c1
Sequence:CCGGCTTCTCTCTCTGGAATCAGATCTCGAGATCTGATTCCAGAGAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144686.2-615s21c1
Sequence:CCGGGCGCTTCCTGCTCCTTCTTAACTCGAGTTAAGAAGGAGCAGGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144686.2-2355s21c1
Sequence:CCAGAGCTTTGGTATCTGGAGATTTCTCGAGAAATCTCCAGATACCAAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks