EMAIL THIS PAGE TO A FRIEND

TMC5

transmembrane channel-like 5

UniProtKB ID: Q6UXY8, Q68DK8, Q8IY20, Q8NHV6, Q9H8I7
Gene ID:
Mouse(74424) transmembrane channel-like gene family 5
Rat(365360) transmembrane channel-like 5
chicken(416611) transmembrane channel-like 5
Horse(100052413) transmembrane channel-like 5
domestic cat(101093981) transmembrane channel-like 5
dog(489989) transmembrane channel-like 5
domestic guinea pig(100735225) transmembrane channel-like 5
naked mole-rat(101702116) transmembrane channel-like 5
Domestic Rabbit(100343716) transmembrane channel-like 5
cow(513865) transmembrane channel-like 5
sheep(101116951) transmembrane channel-like 5
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024780 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105248 Rosetta Predictions human pricing
NM_001105249 Rosetta Predictions human pricing
NM_024780 Rosetta Predictions human pricing
NM_001012216 Rosetta Predictions rat pricing
XM_341913 Rosetta Predictions rat pricing
NM_001105252 Rosetta Predictions mouse pricing
NM_028930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324064 predicted 3008
2 SASI_Hs02_00324065 predicted 2723
3 SASI_Hs02_00324066 predicted 2997
4 SASI_Hs02_00324067 predicted 3080
5 SASI_Hs02_00324068 predicted 2004
6 SASI_Hs02_00324069 predicted 2650
7 SASI_Hs02_00324070 predicted 2246
8 SASI_Hs02_00324071 predicted 2150
9 SASI_Hs02_00324072 predicted 2195
10 SASI_Hs02_00324073 predicted 2719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324074 predicted 3008
2 SASI_Hs02_00324075 predicted 2721
3 SASI_Hs02_00324076 predicted 3000
4 SASI_Hs02_00324077 predicted 3077
5 SASI_Hs02_00324078 predicted 2011
6 SASI_Hs02_00324079 predicted 2652
7 SASI_Hs02_00324080 predicted 2241
8 SASI_Hs02_00324081 predicted 2150
9 SASI_Hs02_00324082 predicted 2198
10 SASI_Hs02_00324083 predicted 2714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068869 predicted 1781
2 SASI_Hs01_00068870 predicted 1494
3 SASI_Hs02_00357303 predicted 1772
4 SASI_Hs02_00357304 predicted 1848
5 SASI_Hs02_00357305 predicted 774
6 SASI_Hs02_00357306 predicted 1424
7 SASI_Hs02_00357307 predicted 1016
8 SASI_Hs02_00357308 predicted 924
9 SASI_Hs02_00357309 predicted 964
10 SASI_Hs01_00068875 predicted 1489
11 SASI_Hs01_00068871 predicted 2087
12 SASI_Hs01_00068872 predicted 1812
13 SASI_Hs01_00068873 predicted 718
14 SASI_Hs01_00068874 predicted 768
15 SASI_Hs01_00068876 predicted 2145
16 SASI_Hs01_00068877 predicted 523
17 SASI_Hs01_00068878 predicted 1846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200463 predicted 1093
2 SASI_Rn02_00200464 predicted 1387
3 SASI_Rn02_00200465 predicted 1360
4 SASI_Rn02_00200466 predicted 593
5 SASI_Rn02_00200467 predicted 2153
6 SASI_Rn02_00200468 predicted 1751
7 SASI_Rn02_00200469 predicted 839
8 SASI_Rn02_00200470 predicted 889
9 SASI_Rn02_00200471 predicted 872
10 SASI_Rn02_00200472 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175841 predicted 1179
2 SASI_Rn01_00175842 predicted 817
3 SASI_Rn01_00175843 predicted 841
4 SASI_Rn01_00175844 predicted 737
5 SASI_Rn01_00175845 predicted 1414
6 SASI_Rn01_00175846 predicted 927
7 SASI_Rn01_00175847 predicted 1659
8 SASI_Rn01_00175848 predicted 1706
9 SASI_Rn01_00175849 predicted 792
10 SASI_Rn01_00175850 predicted 1696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303985 predicted 2238
2 SASI_Mm02_00303986 predicted 3262
3 SASI_Mm02_00303987 predicted 2658
4 SASI_Mm02_00303988 predicted 3172
5 SASI_Mm02_00303989 predicted 1591
6 SASI_Mm02_00303990 predicted 2247
7 SASI_Mm02_00303991 predicted 3142
8 SASI_Mm02_00303992 predicted 2953
9 SASI_Mm02_00303993 predicted 2902
10 SASI_Mm02_00303994 predicted 3346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178016 predicted 1389
2 SASI_Mm01_00178017 predicted 2410
3 SASI_Mm01_00178018 predicted 1809
4 SASI_Mm01_00178019 predicted 2326
5 SASI_Mm01_00178021 predicted 745
6 SASI_Mm02_00334625 predicted 1406
7 SASI_Mm02_00334626 predicted 2291
8 SASI_Mm01_00178022 predicted 2108
9 SASI_Mm01_00178023 predicted 2052
10 SASI_Mm01_00178024 predicted 2500
11 SASI_Mm01_00178015 predicted 1979
12 SASI_Mm01_00178020 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024780
VALIDATED
TMC5 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024780.4-3002s21c1
Sequence:CCGGCCTGCATTTATTTGTGACTTTCTCGAGAAAGTCACAAATAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024780.3-1427s1c2
Sequence:CCGGCGTTTATTACCTGGCTGAGTACTCGAGTACTCAGCCAGGTAATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024780.4-1500s21c1
Sequence:CCGGCCTTTCGTTGTGTCCTGCATTCTCGAGAATGCAGGACACAACGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024780.4-778s21c1
Sequence:CCGGGCCTGTCGGAAATTCTGAATTCTCGAGAATTCAGAATTTCCGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024780.4-2416s21c1
Sequence:CCGGCCAGCTCACTTGTTCTGGAAACTCGAGTTTCCAGAACAAGTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024780.3-3002s1c1
Sequence:CCGGCCTGCATTTATTTGTGACTTTCTCGAGAAAGTCACAAATAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024780.3-2416s1c1
Sequence:CCGGCCAGCTCACTTGTTCTGGAAACTCGAGTTTCCAGAACAAGTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024780.3-778s1c1
Sequence:CCGGGCCTGTCGGAAATTCTGAATTCTCGAGAATTCAGAATTTCCGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024780.3-1500s1c1
Sequence:CCGGCCTTTCGTTGTGTCCTGCATTCTCGAGAATGCAGGACACAACGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024780
VALIDATED
TMC5 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024780.4-3002s21c1
Sequence:CCGGCCTGCATTTATTTGTGACTTTCTCGAGAAAGTCACAAATAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024780.3-1427s1c2
Sequence:CCGGCGTTTATTACCTGGCTGAGTACTCGAGTACTCAGCCAGGTAATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024780.4-1500s21c1
Sequence:CCGGCCTTTCGTTGTGTCCTGCATTCTCGAGAATGCAGGACACAACGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024780.4-778s21c1
Sequence:CCGGGCCTGTCGGAAATTCTGAATTCTCGAGAATTCAGAATTTCCGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024780.4-2416s21c1
Sequence:CCGGCCAGCTCACTTGTTCTGGAAACTCGAGTTTCCAGAACAAGTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024780.3-3002s1c1
Sequence:CCGGCCTGCATTTATTTGTGACTTTCTCGAGAAAGTCACAAATAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024780.3-2416s1c1
Sequence:CCGGCCAGCTCACTTGTTCTGGAAACTCGAGTTTCCAGAACAAGTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024780.3-778s1c1
Sequence:CCGGGCCTGTCGGAAATTCTGAATTCTCGAGAATTCAGAATTTCCGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024780.3-1500s1c1
Sequence:CCGGCCTTTCGTTGTGTCCTGCATTCTCGAGAATGCAGGACACAACGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024780
VALIDATED
TMC5 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024780.4-3002s21c1
Sequence:CCGGCCTGCATTTATTTGTGACTTTCTCGAGAAAGTCACAAATAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024780.3-1427s1c2
Sequence:CCGGCGTTTATTACCTGGCTGAGTACTCGAGTACTCAGCCAGGTAATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024780.4-1500s21c1
Sequence:CCGGCCTTTCGTTGTGTCCTGCATTCTCGAGAATGCAGGACACAACGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_024780.4-778s21c1
Sequence:CCGGGCCTGTCGGAAATTCTGAATTCTCGAGAATTCAGAATTTCCGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024780.4-2416s21c1
Sequence:CCGGCCAGCTCACTTGTTCTGGAAACTCGAGTTTCCAGAACAAGTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024780.3-3002s1c1
Sequence:CCGGCCTGCATTTATTTGTGACTTTCTCGAGAAAGTCACAAATAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_024780.3-2416s1c1
Sequence:CCGGCCAGCTCACTTGTTCTGGAAACTCGAGTTTCCAGAACAAGTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024780.3-778s1c1
Sequence:CCGGGCCTGTCGGAAATTCTGAATTCTCGAGAATTCAGAATTTCCGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024780.3-1500s1c1
Sequence:CCGGCCTTTCGTTGTGTCCTGCATTCTCGAGAATGCAGGACACAACGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028930
TMC5 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-1011s1c1
Sequence:CCGGCCAATTCTACAATCCGACATACTCGAGTATGTCGGATTGTAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-2423s1c1
Sequence:CCGGCCTTTGCATTTGGAGGAACTTCTCGAGAAGTTCCTCCAAATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-561s1c1
Sequence:CCGGCCATGACAACTAGAGACAGAACTCGAGTTCTGTCTCTAGTTGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-778s1c1
Sequence:CCGGGCAGAAGAGATTCAAGGTCATCTCGAGATGACCTTGAATCTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-2227s1c1
Sequence:CCGGGCTAATCATCACCTATCTTTACTCGAGTAAAGATAGGTGATGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028930
TMC5 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-1011s1c1
Sequence:CCGGCCAATTCTACAATCCGACATACTCGAGTATGTCGGATTGTAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-2423s1c1
Sequence:CCGGCCTTTGCATTTGGAGGAACTTCTCGAGAAGTTCCTCCAAATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-561s1c1
Sequence:CCGGCCATGACAACTAGAGACAGAACTCGAGTTCTGTCTCTAGTTGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-778s1c1
Sequence:CCGGGCAGAAGAGATTCAAGGTCATCTCGAGATGACCTTGAATCTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-2227s1c1
Sequence:CCGGGCTAATCATCACCTATCTTTACTCGAGTAAAGATAGGTGATGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028930
TMC5 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-1011s1c1
Sequence:CCGGCCAATTCTACAATCCGACATACTCGAGTATGTCGGATTGTAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-2423s1c1
Sequence:CCGGCCTTTGCATTTGGAGGAACTTCTCGAGAAGTTCCTCCAAATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-561s1c1
Sequence:CCGGCCATGACAACTAGAGACAGAACTCGAGTTCTGTCTCTAGTTGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-778s1c1
Sequence:CCGGGCAGAAGAGATTCAAGGTCATCTCGAGATGACCTTGAATCTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028930.1-2227s1c1
Sequence:CCGGGCTAATCATCACCTATCTTTACTCGAGTAAAGATAGGTGATGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks