EMAIL THIS PAGE TO A FRIEND

TMC6

transmembrane channel-like 6

Synonyms: EV1 EVER1 EVIN1 LAK-4P
Gene ID:
Human(11322) Summary: Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 10 transmembrane domains and 2 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Mouse(217353) transmembrane channel-like gene family 6
cow(505575) transmembrane channel-like 6
sheep(101115049) transmembrane channel-like 6
naked mole-rat(101696330) transmembrane channel-like 6
domestic guinea pig(100729981) transmembrane channel-like 6
chicken(422089) transmembrane channel-like 6
dog(483341) transmembrane channel-like 6
Horse(100058089) transmembrane channel-like 6
domestic cat(101080340) transmembrane channel-like 6
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007267 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127198 Rosetta Predictions human pricing
NM_007267 Rosetta Predictions human pricing
NM_145439 Rosetta Predictions mouse pricing
NM_181321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328707 predicted 1152
2 SASI_Hs02_00328708 predicted 1941
3 SASI_Hs02_00328709 predicted 1399
4 SASI_Hs02_00328710 predicted 395
5 SASI_Hs02_00328711 predicted 1275
6 SASI_Hs02_00328712 predicted 1150
7 SASI_Hs02_00328713 predicted 1150
8 SASI_Hs02_00328714 predicted 2005
9 SASI_Hs02_00328715 predicted 975
10 SASI_Hs02_00328716 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181752 predicted 1049
2 SASI_Hs01_00181753 predicted 1839
3 SASI_Hs01_00181754 predicted 1299
4 SASI_Hs01_00181755 predicted 292
5 SASI_Hs01_00181756 predicted 1165
6 SASI_Hs01_00181758 predicted 1047
7 SASI_Hs01_00181759 predicted 1045
8 SASI_Hs02_00343302 predicted 1905
9 SASI_Hs01_00181761 predicted 876
10 SASI_Hs02_00343303 predicted 1851
11 SASI_Hs01_00181757 predicted 2486
12 SASI_Hs01_00181760 predicted 2541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153269 predicted 1045
2 SASI_Mm01_00153270 predicted 420
3 SASI_Mm01_00153272 predicted 1050
4 SASI_Mm01_00153273 predicted 2423
5 SASI_Mm01_00153274 predicted 1379
6 SASI_Mm01_00153275 predicted 911
7 SASI_Mm01_00153276 predicted 1269
8 SASI_Mm01_00153277 predicted 1383
9 SASI_Mm01_00153278 predicted 584
10 SASI_Mm02_00340818 predicted 1647
11 SASI_Mm01_00153271 predicted 2203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150554 predicted 440
2 SASI_Mm01_00150555 predicted 769
3 SASI_Mm01_00150556 predicted 843
4 SASI_Mm01_00150558 predicted 440
5 SASI_Mm01_00150559 predicted 779
6 SASI_Mm01_00150560 predicted 924
7 SASI_Mm02_00349673 predicted 567
8 SASI_Mm01_00150561 predicted 593
9 SASI_Mm01_00150562 predicted 855
10 SASI_Mm01_00150563 predicted 593
11 SASI_Mm01_00150557 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145439
TMC6 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145439.1-2639s1c1
Sequence:CCGGCCATGAACTCTAGTTGGCATACTCGAGTATGCCAACTAGAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-1049s1c1
Sequence:CCGGCACAGTTATGTACTACGGCTACTCGAGTAGCCGTAGTACATAACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-2339s1c1
Sequence:CCGGGCTGGCTGTCATCTACTTCAACTCGAGTTGAAGTAGATGACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-585s1c1
Sequence:CCGGCTGCTAGTAAAGGAGCTTCAACTCGAGTTGAAGCTCCTTTACTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-2196s1c1
Sequence:CCGGCGGACTCTGAACACCATGTATCTCGAGATACATGGTGTTCAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145439.2-1455s21c1
Sequence:CCGGGCTGAATGGCACCTTCGAAAGCTCGAGCTTTCGAAGGTGCCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145439.2-740s21c1
Sequence:CCGGGAAGCGCTGTCTTCGAGAGAACTCGAGTTCTCTCGAAGACAGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145439
TMC6 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145439.1-2639s1c1
Sequence:CCGGCCATGAACTCTAGTTGGCATACTCGAGTATGCCAACTAGAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-1049s1c1
Sequence:CCGGCACAGTTATGTACTACGGCTACTCGAGTAGCCGTAGTACATAACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-2339s1c1
Sequence:CCGGGCTGGCTGTCATCTACTTCAACTCGAGTTGAAGTAGATGACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-585s1c1
Sequence:CCGGCTGCTAGTAAAGGAGCTTCAACTCGAGTTGAAGCTCCTTTACTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-2196s1c1
Sequence:CCGGCGGACTCTGAACACCATGTATCTCGAGATACATGGTGTTCAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145439.2-1455s21c1
Sequence:CCGGGCTGAATGGCACCTTCGAAAGCTCGAGCTTTCGAAGGTGCCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145439.2-740s21c1
Sequence:CCGGGAAGCGCTGTCTTCGAGAGAACTCGAGTTCTCTCGAAGACAGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145439
TMC6 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145439.1-2639s1c1
Sequence:CCGGCCATGAACTCTAGTTGGCATACTCGAGTATGCCAACTAGAGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-1049s1c1
Sequence:CCGGCACAGTTATGTACTACGGCTACTCGAGTAGCCGTAGTACATAACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-2339s1c1
Sequence:CCGGGCTGGCTGTCATCTACTTCAACTCGAGTTGAAGTAGATGACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-585s1c1
Sequence:CCGGCTGCTAGTAAAGGAGCTTCAACTCGAGTTGAAGCTCCTTTACTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145439.1-2196s1c1
Sequence:CCGGCGGACTCTGAACACCATGTATCTCGAGATACATGGTGTTCAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145439.2-1455s21c1
Sequence:CCGGGCTGAATGGCACCTTCGAAAGCTCGAGCTTTCGAAGGTGCCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145439.2-740s21c1
Sequence:CCGGGAAGCGCTGTCTTCGAGAGAACTCGAGTTCTCTCGAAGACAGCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007267
TMC6 MISSION shRNA Bacterial Glycerol Stock
transmembrane channel-like 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007267.5-2638s1c1
Sequence:CCGGCCAGGACAAGGAAGACAGTTTCTCGAGAAACTGTCTTCCTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-2533s1c1
Sequence:CCGGCTGCTCACAGATGAACAGGATCTCGAGATCCTGTTCATCTGTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-1188s1c1
Sequence:CCGGGAGCTTCTTTATCACCTGCATCTCGAGATGCAGGTGATAAAGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-2454s1c1
Sequence:CCGGTCACTCCATCTACGAGAGGAACTCGAGTTCCTCTCGTAGATGGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-1050s1c1
Sequence:CCGGCGTCATGTACTACGGCCACTACTCGAGTAGTGGCCGTAGTACATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007267.6-1333s21c1
Sequence:CCGGCGCCTCCAGCAGGACAATATTCTCGAGAATATTGTCCTGCTGGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007267.6-1843s21c1
Sequence:CCGGGAACTGGTGTGGAGGATTATCCTCGAGGATAATCCTCCACACCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007267.6-1916s21c1
Sequence:CCGGATGTCCTGGAGCTGATTTATGCTCGAGCATAAATCAGCTCCAGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007267
TMC6 MISSION shRNA shRNA Plasmid DNA
transmembrane channel-like 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007267.5-2638s1c1
Sequence:CCGGCCAGGACAAGGAAGACAGTTTCTCGAGAAACTGTCTTCCTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-2533s1c1
Sequence:CCGGCTGCTCACAGATGAACAGGATCTCGAGATCCTGTTCATCTGTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-1188s1c1
Sequence:CCGGGAGCTTCTTTATCACCTGCATCTCGAGATGCAGGTGATAAAGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-2454s1c1
Sequence:CCGGTCACTCCATCTACGAGAGGAACTCGAGTTCCTCTCGTAGATGGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-1050s1c1
Sequence:CCGGCGTCATGTACTACGGCCACTACTCGAGTAGTGGCCGTAGTACATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007267.6-1333s21c1
Sequence:CCGGCGCCTCCAGCAGGACAATATTCTCGAGAATATTGTCCTGCTGGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007267.6-1843s21c1
Sequence:CCGGGAACTGGTGTGGAGGATTATCCTCGAGGATAATCCTCCACACCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007267.6-1916s21c1
Sequence:CCGGATGTCCTGGAGCTGATTTATGCTCGAGCATAAATCAGCTCCAGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007267
TMC6 MISSION shRNA Lentiviral Transduction Particles
transmembrane channel-like 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119002    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007267.5-2638s1c1
Sequence:CCGGCCAGGACAAGGAAGACAGTTTCTCGAGAAACTGTCTTCCTTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-2533s1c1
Sequence:CCGGCTGCTCACAGATGAACAGGATCTCGAGATCCTGTTCATCTGTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-1188s1c1
Sequence:CCGGGAGCTTCTTTATCACCTGCATCTCGAGATGCAGGTGATAAAGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-2454s1c1
Sequence:CCGGTCACTCCATCTACGAGAGGAACTCGAGTTCCTCTCGTAGATGGAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007267.5-1050s1c1
Sequence:CCGGCGTCATGTACTACGGCCACTACTCGAGTAGTGGCCGTAGTACATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007267.6-1333s21c1
Sequence:CCGGCGCCTCCAGCAGGACAATATTCTCGAGAATATTGTCCTGCTGGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007267.6-1843s21c1
Sequence:CCGGGAACTGGTGTGGAGGATTATCCTCGAGGATAATCCTCCACACCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007267.6-1916s21c1
Sequence:CCGGATGTCCTGGAGCTGATTTATGCTCGAGCATAAATCAGCTCCAGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks